Почерняєв Костянтин Федорович

Спосіб індикації днк бактерії chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 123070

Опубліковано: 12.02.2018

Автори: Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: C12Q 1/68, A61K 39/118, C12R 1/01 ...

Мітки: індикації, днк, момр, гена, полімеразній, chlamydia, спосіб, шляхом, ланцюговий, головного, видової, бактерії, ампліфікації, диференціації, білка, фрагменту, мембрани, avium, реакції

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia avium здійснюють за допомогою пари праймерів: прямого: ChAvMOMPL: 5' - TTCTGGTGATCCTTGCGACC-3' та зворотного: ChAvMOMPR: 5'- GCTCCTAAAGTTGCACAACC - 3', з одержанням...

Спосіб індикації шести та диференціації трьох видів збудників бабезіозів тварин у мультиплексній полімеразній ланцюговій реакції

Завантаження...

Номер патенту: 118964

Опубліковано: 11.09.2017

Автори: Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович, Курман Андрій Федорович, Мокрий Юрій Олексійович

МПК: C12R 1/90, C12Q 1/68

Мітки: мультиплексній, полімеразній, бабезіозів, ланцюговий, збудникiв, трьох, реакції, індикації, диференціації, видів, шести, спосіб, тварин

Формула / Реферат:

Спосіб визначення ДНК найпростіших роду Babesia у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена 18S рРНК, який відрізняється тим, що ампліфікацію означеного фрагмента гена 18S рРНК представників роду Babesia шести видів та видову диференціацію трьох із них здійснюють за допомогою системи олігонуклеотидних праймерів - двох прямих: BCANF 5'-GTGACCCAAACCCTCACCAGA-3' і BSPF 5'-ССА-TTGGAGGGCAAGTCTGGT-3' та трьох зворотних:...

Спосіб індикації днк бактерії chlamydia pneumoniae у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 117492

Опубліковано: 26.06.2017

Автори: Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович

МПК: A61K 39/118

Мітки: реакції, мембрани, головного, фрагмента, білка, індикації, спосіб, chlamydia, ланцюговий, бактерії, днк, pneumoniae, видової, диференціації, гена, полімеразній, ампліфікації, шляхом, момр

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia рnеumoniae у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia рnеumoniae здійснюють за допомогою пари праймерів: прямого: ChPnMOMPL: 5'-GGAACAAAGTCTGCGACCAT-3' та зворотного: ChPnMOMPR: 5'-AAAGAAGGGTTCCATGCAGTT-3', з...

Спосіб індикації днк бактерії chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117100

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: C12R 1/01, C12Q 1/68

Мітки: мембрани, ланцюговий, pecorum, chlamydia, фрагмента, шляхом, бактерії, днк, реакції, індикації, спосіб, головного, полімеразній, гена, білка, диференціації, момp, видової, ампліфікації

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia pecorum здійснюють за допомогою пари праймерів: прямого: ChPecMOMPL 5'-TCCAATACGCACAATCGAAA-3' та зворотного: ChPecMOMPR 5'-GTAAGACAACGCTGCACCAA-3', з одержанням...

Спосіб індикації днк бактерії chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117099

Опубліковано: 12.06.2017

Автори: Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович

МПК: C12Q 1/68, C12R 1/01

Мітки: chlamydia, гена, днк, ланцюговий, спосіб, момp, мембрани, видової, бактерії, диференціації, головного, реакції, фрагмента, індикації, шляхом, ампліфікації, полімеразній, білка

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia suis здійснюють за допомогою пари праймерів: прямого: ChSuMOMPL: 5'- TTCTTTGCAATGCTGCTGAA-3' та зворотного: ChSuMOMPR: 5'- ATCAAAGCTTGCTCGAGACC-3', з одержанням...

Спосіб індикації днк бактерії chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 117097

Опубліковано: 12.06.2017

Автори: Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович

МПК: C12R 1/01, C12Q 1/68

Мітки: ланцюговий, полімеразній, гена, ампліфікації, бактерії, днк, видової, psittaci, індикації, головного, фрагмента, білка, шляхом, диференціації, спосіб, момр, chlamydia, мембрани, реакції

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia psittaci здійснюють за допомогою пари праймерів: прямого: ChPsMOMPL: 5'-GCACTATGTGGGAAGGTGCT-3' та зворотного: ChPsMOMPR: 5'-CCATTTGCTTCTGGCTGATT-3', з одержанням...

Спосіб індикації днк бактерії chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117091

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: C12Q 1/68, C12R 1/01

Мітки: chlamydia, спосіб, шляхом, abortus, білка, бактерії, полімеразній, момp, ампліфікації, видової, днк, індикації, реакції, мембрани, диференціації, фрагмента, гена, ланцюговий, головного

Формула / Реферат:

Спосіб індикації ДНК бактерій Chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР) для її видової диференціації, який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia abortus здійснюють за допомогою пари праймерів: прямого: ChAbMOMPL: 5'-GGATAGACCCAACATCGCTT-3' та зворотного: ChAbMOMPR:...

Спосіб генотипування свиней на основі мікросателітних маркерів з тетрануклеотидними повторами

Завантаження...

Номер патенту: 114145

Опубліковано: 25.04.2017

Автори: Почерняєв Костянтин Федорович, Корінний Сергій Миколайович

МПК: A01K 67/02, C12N 15/11

Мітки: мікросателітних, основі, свиней, спосіб, генотипування, повторами, маркерів, тетрануклеотидними

Формула / Реферат:

Спосіб генотипування свиней на основі мікросателітних маркерів з тетрануклеотидними повторами, який відрізняється тим, що специфічними олігонуклеотидними праймерами, що дозволяють отримувати продукти ампліфікації мікросателітних локусів від 84 до 220 пар нуклеотидів, є:FH3628прямий праймер: 5'-GGCAATGGAGTGACTGTG-3',зворотний праймер: 5'-GCTTTATACAACTTAGGAAGCCCA-3',FH1865прямий праймер:...

Спосіб визначення днк бактерій виду chlamydia abortus, chlamydia pecorum, chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу р (rnase p rna)

Завантаження...

Номер патенту: 110546

Опубліковано: 12.01.2016

Автори: Почерняєв Костянтин Федорович, Цівенко Тетяна Михайлівна, Ксьонз Ігор Миколайович

МПК: C12R 1/01, C12Q 1/68

Мітки: виду, ланцюговий, фрагмента, реакції, psittaci, гена, бактерій, chlamydia, визначення, полімеразній, ендорибонуклеазу, спосіб, днк, rnase, pecorum, ампліфікації, шляхом, abortus, кодує

Формула / Реферат:

Спосіб визначення ДНК бактерій виду Chlamydia abortus, Chlamydia pecorum, Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу Р (RNase Р RNA), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки фрагмента гена RNase Р RNA здійснюють за допомогою пари праймерів: прямого:CHCPF:5`-GGAGAAACTCCAGGGGCCGT-3` та зворотного:...

Спосіб визначення днк бактерій chlamydia felis у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр)

Завантаження...

Номер патенту: 109489

Опубліковано: 25.08.2015

Автори: Цівенко Тетяна Михайлівна, Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: C12R 1/01, C12Q 1/68

Мітки: шляхом, фрагменту, мембрани, момр, спосіб, реакції, визначення, chlamydia, білка, ланцюговий, полімеразній, днк, бактерій, felis, гена, головного, ампліфікації

Формула / Реферат:

Спосіб визначення ДНК збудника хламідійних інфекцій домашніх котів у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки ДНК МОМР бактерії Chlamydia felis здійснюють з використанням пари праймерів: прямого CHFMF 5'-GCAGCTTCTGGAACTGCAAGC-3' та зворотного CHFMR 5'-GGCGАААТСAGTTCCTGCAAGА-3' з одержанням...

Спосіб генотипування свиней за геном гормону росту по bsuri-поліморфному сайту рестрикції

Завантаження...

Номер патенту: 65963

Опубліковано: 26.12.2011

Автори: Почерняєв Костянтин Федорович, Балацький Віктор Миколайович, Саєнко Артем Михайлович

МПК: A01K 67/00

Мітки: генотипування, рестрикції, bsuri-поліморфному, сайту, росту, свиней, геном, гормону, спосіб

Формула / Реферат:

Спосіб генотипування свиней за геном гормону росту по BsuRI-поліморфному сайту рестрикції, який характеризується тим, що рестриктний аналіз фрагмента гена гормону росту ендонуклеазою BsuR I, попередньо ампліфікованого за допомогою полімеразної реакції, в якій використовують специфічні праймери:5'-ACCGGCTGTGATGGCTGCAGGCAA-3' та5'-AGGTGGGCGCCTTCCCAGCCATGCCCTT-3'.

Спосіб визначення днк бактерій родини chlamydiaceae у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр)

Завантаження...

Номер патенту: 51635

Опубліковано: 26.07.2010

Автори: Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: A61K 39/118

Мітки: ланцюговий, бактерій, полімеразній, реакції, ампліфікації, днк, мембрани, chlamydiaceae, гена, спосіб, родини, головного, визначення, момр, шляхом, білка, фрагмента

Формула / Реферат:

Спосіб визначення ДНК бактерій родини Chlamydiaceae у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани(МОМР), який відрізняється тим, що при цьому у полімеразній ланцюговій реакції ампліфікується однакова за нуклеотидним складом ділянка ДНК з молекулярною масою - 221 пари нуклеотидів бактерій родини Chlamydiacea, що викликають захворювання у ссавців і птахів незалежно від їх виду.

Спосіб визначення днк семи збудників хламідійних інфекцій ссавців і птахів у одній полімеразній ланцюговій реакції

Завантаження...

Номер патенту: 34868

Опубліковано: 26.08.2008

Автори: Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: A61K 39/118

Мітки: днк, птахів, визначення, спосіб, хламідійних, ссавців, ланцюговий, реакції, інфекцій, полімеразній, одний, семи, збудникiв

Формула / Реферат:

Спосіб визначення ДНК збудників хламідійних інфекцій у полімеразній ланцюговій реакції (ПЛР), який відрізняється тим, що у одній полімеразній ланцюговій реакції виявляється ділянка ДНК семи видів бактерій родини Chlamydiacea, що викликають захворювання у ссавців і птахів.

Спосіб визначення днк збудників хламідійних інфекцій у мультиплексній полімеразній ланцюговій реакції

Завантаження...

Номер патенту: 11834

Опубліковано: 16.01.2006

Автори: Курман Андрій Федорович, Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: A61K 39/118

Мітки: збудникiв, спосіб, ланцюговий, визначення, реакції, інфекцій, днк, мультиплексній, полімеразній, хламідійних

Формула / Реферат:

Спосіб визначення ДНК збудників хламідійних інфекцій у мультиплексній полімеразній ланцюговій реакції, який відрізняється тим, що при цьому полімеразну ланцюгову реакцію використовують для визначення збудників хламідійних інфекцій тварин і птахів за видами.

Спосіб визначення мітохондріальних гаплотипів свиней

Завантаження...

Номер патенту: 6400

Опубліковано: 16.05.2005

Автор: Почерняєв Костянтин Федорович

МПК: A61D 7/00

Мітки: мітохондріальних, визначення, спосіб, гаплотипів, свиней

Формула / Реферат:

Спосіб визначення мітохондріальних гаплотипів свиней, який передбачає рестриктний аналіз фрагмента мітохондріального геному свині, попередньо ампліфікованого за допомогою полімеразної реакції, який відрізняється тим, що для полімеразної ланцюгової реакції використовуються праймери, що складаються з таких послідовностей: 5'-САТ АСА ААТ АТО TGA ССС САА А-3' (MITPRO2F), 5'-GTG AGC ATG GGC TGA ТТА GTC-3' (MITPROR), які дозволяють ампліфікувати...