C12R 1/01 — бактерії або актиноміцети

Спосіб індикації днк бактерії chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 123070

Опубліковано: 12.02.2018

Автори: Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна

МПК: C12R 1/01, C12Q 1/68, A61K 39/118 ...

Мітки: індикації, диференціації, білка, фрагменту, avium, видової, chlamydia, момр, спосіб, бактерії, днк, реакції, ланцюговий, головного, шляхом, полімеразній, мембрани, гена, ампліфікації

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia avium здійснюють за допомогою пари праймерів: прямого: ChAvMOMPL: 5' - TTCTGGTGATCCTTGCGACC-3' та зворотного: ChAvMOMPR: 5'- GCTCCTAAAGTTGCACAACC - 3', з одержанням...

Бінарна композиція штамів bradyrhizobium japonicum 3 різною швидкістю росту для підвищення продуктивності сої

Завантаження...

Номер патенту: 114981

Опубліковано: 28.08.2017

Автор: Крутило Дмитро Валерійович

МПК: C12N 1/20, C05F 11/08, C12R 1/01 ...

Мітки: композиція, росту, продуктивності, різною, бінарна, сої, bradyrhizobium, japonicum, штамів, швидкістю, підвищення

Формула / Реферат:

Бінарна композиція штамів Bradyrhizobium japonicum з різною швидкістю росту для підвищення продуктивності сої, яка відрізняється тим, що містить два штами бульбочкових бактерій сої повільнорослий Bradyrhizobium japonicum B-7200 та інтенсивнорослий Bradyrhizobium japonicum B-7435 у співвідношенні 1:1.

Спосіб виявлення дезоксирибонуклеїнової кислоти (днк) бактерій cronobacter spp. (enterobacter sakazakii)

Завантаження...

Номер патенту: 118844

Опубліковано: 28.08.2017

Автори: Бергілевич Олександра Миколаївна, Касянчук Вікторія Вікторівна, Дерябін Олег Миколайович, Коростіль Сергій Олексійович, Моня Юлія Іванівна, Терьохіна Олена Вікторівна

МПК: C12R 1/01, C12Q 1/68

Мітки: cronobacter, спосіб, виявлення, днк, кислоти, enterobacter, бактерій, дезоксирибонуклеїнової, sakazakii

Формула / Реферат:

Спосіб виявлення дезоксирибонуклеїнової кислоти (ДНК) бактерій Cronobacter spp. (Enterobacter sakazakii), що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) за допомогою мультиплексного варіанту полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно синтезовані олігонуклеотидні праймери, які є специфічними фрагментами до гену 16S rRNA, з наступною...

Спосіб індикації днк бактерії chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117100

Опубліковано: 12.06.2017

Автори: Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович, Корнієнко Марина Володимирівна

МПК: C12R 1/01, C12Q 1/68

Мітки: реакції, білка, спосіб, chlamydia, головного, днк, шляхом, індикації, фрагмента, бактерії, мембрани, момp, ланцюговий, pecorum, полімеразній, видової, ампліфікації, диференціації, гена

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia pecorum здійснюють за допомогою пари праймерів: прямого: ChPecMOMPL 5'-TCCAATACGCACAATCGAAA-3' та зворотного: ChPecMOMPR 5'-GTAAGACAACGCTGCACCAA-3', з одержанням...

Спосіб індикації днк бактерії chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117099

Опубліковано: 12.06.2017

Автори: Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна

МПК: C12R 1/01, C12Q 1/68

Мітки: днк, фрагмента, бактерії, видової, білка, шляхом, головного, ампліфікації, chlamydia, полімеразній, ланцюговий, диференціації, момp, мембрани, індикації, гена, спосіб, реакції

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia suis здійснюють за допомогою пари праймерів: прямого: ChSuMOMPL: 5'- TTCTTTGCAATGCTGCTGAA-3' та зворотного: ChSuMOMPR: 5'- ATCAAAGCTTGCTCGAGACC-3', з одержанням...

Спосіб індикації днк бактерії chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 117097

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: C12R 1/01, C12Q 1/68

Мітки: реакції, chlamydia, момр, фрагмента, видової, ампліфікації, гена, мембрани, полімеразній, головного, диференціації, шляхом, бактерії, ланцюговий, індикації, білка, днк, спосіб, psittaci

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia psittaci здійснюють за допомогою пари праймерів: прямого: ChPsMOMPL: 5'-GCACTATGTGGGAAGGTGCT-3' та зворотного: ChPsMOMPR: 5'-CCATTTGCTTCTGGCTGATT-3', з одержанням...

Спосіб індикації днк бактерії chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117091

Опубліковано: 12.06.2017

Автори: Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович

МПК: C12Q 1/68, C12R 1/01

Мітки: індикації, момp, гена, abortus, мембрани, головного, шляхом, реакції, бактерії, ланцюговий, диференціації, видової, білка, ампліфікації, chlamydia, днк, фрагмента, полімеразній, спосіб

Формула / Реферат:

Спосіб індикації ДНК бактерій Chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР) для її видової диференціації, який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia abortus здійснюють за допомогою пари праймерів: прямого: ChAbMOMPL: 5'-GGATAGACCCAACATCGCTT-3' та зворотного: ChAbMOMPR:...

Спосіб отримання культури “бородатих” коренів рослин artemisia dracunculus l.

Завантаження...

Номер патенту: 116312

Опубліковано: 10.05.2017

Автори: Дуплій Володимир Павлович, Матвєєва Надія Анатоліївна, Дробот Катерина Олександрівна, Шаховський Анатолій Михайлович

МПК: A01H 4/00, C12N 1/20, C12N 1/00 ...

Мітки: dracunculus, культури, artemisia, коренів, отримання, рослин, бородатих, спосіб

Формула / Реферат:

Спосіб отримання культури "бородатих" коренів рослин Artemisia dracunculus L., який включає підготовку суспензії Agrobacterium rhizogenes; відокремлення листків від асептичних рослин; поранення листових експлантів; інокуляцію експлантів суспензією агробактерій; кокультивування експлантів із A. rhizogenes на базовому середовищі; елімінацію агробактерій та індукцію "бородатих" коренів на базовому середовищі, доповненому...

Спосіб якісного та кількісного визначення видового складу багатокомпонентних бактеріальних препаратів за допомогою специфічних праймерів методом полімеразної ланцюгової реакції реального часу

Завантаження...

Номер патенту: 115774

Опубліковано: 25.04.2017

Автори: Літовченко Олександр Вікторович, Янковський Дмитро Станіславович, Кітам Володимир Олегович, Димент Галина Семенівна, Шевченко Любов Миколаївна, Шевченко Тетяна Вікторівна, Коробка Вадим Леонідович

МПК: C12R 1/01, C12N 1/20

Мітки: складу, спосіб, ланцюгової, реального, реакції, допомогою, праймерів, визначення, специфічних, препаратів, багатокомпонентних, якісного, бактеріальних, видового, методом, кількісного, полімеразної, часу

Формула / Реферат:

Спосіб якісного та кількісного визначення видового складу багатокомпонентного бактеріального препарату, щомістить представників родів Bifidobacterium, Lactobacillus, Propionibacterium, Lactococcus, Streptococcus та Acetobacter, за допомогою специфічних праймерів методом полімеразної ланцюгової реакції в режимі реального часу, який відрізняється тим, що визначають склад бактеріального препарату на рівні видів Lactobacillus acidophilus,...

Спосіб вирощування соризу

Завантаження...

Номер патенту: 110299

Опубліковано: 10.10.2016

Автори: Дерев'янський Віктор Петрович, Сучек Микола Миколайович, Молдован Віктор Григорович

МПК: C12N 1/20, A01P 1/00, A01N 63/02 ...

Мітки: спосіб, вирощування, сорізу

Формула / Реферат:

Спосіб вирощування соризу для підвищення продуктивності культури, який відрізняється тим, що насіння соризу сорту Титан перед сівбою обробляють Флавобактерином та обприскують посіви у фазі 4-6 листків Кладостимом - 100 мл/га з використанням 200 л/га робочої рідини на фоні заробки сидеральних добрив у ґрунт.

Спосіб одержання поверхнево-активних речовин

Завантаження...

Номер патенту: 111501

Опубліковано: 10.05.2016

Автори: Шулякова Марія Олександрівна, Антонюк Світлана Ігорівна, Пирог Тетяна Павлівна, Антонюк Ніна Олександрівна

МПК: C12R 1/01, C12N 1/00, C12R 1/21 ...

Мітки: одержання, поверхнево-активних, спосіб, речовин

Формула / Реферат:

Спосіб одержання поверхнево-активних речовин включає культивування Acinetobacter calcoaceticus IMB В-7241 на рідкому середовищі, що містить мінеральні солі, як джерело азоту - сечовину, як джерело вуглецевого живлення - технічний гліцерин, 0,16 мкмоль/л сульфату міді і 38 мкмоль/л сульфату цинку, який відрізняється тим, що концентрація сечовини становить 0,7-0,9 г/л.

Спосіб одержання поверхнево-активних речовин

Завантаження...

Номер патенту: 111498

Опубліковано: 10.05.2016

Автори: Савенко Інга Володимирівна, Конон Анастасія Дмитрівна, Пирог Тетяна Павлівна

МПК: C12N 1/20, C12R 1/01, C12R 1/20 ...

Мітки: одержання, спосіб, речовин, поверхнево-активних

Формула / Реферат:

Спосіб одержання поверхнево-активних речовин, що включає культивування штаму Acinetobacter calcoaceticus ІMB В-7241 на рідкому середовищі, що містить мінеральні солі і як джерело вуглецевого живлення пересмажену соняшникову олію (2 %, об'ємна частка), який відрізняється тим, що використовують 6-8 % посівного матеріалу, вирощеного на середовищі з глюкозою 0,8-1,0 %.

Штам бактерій sinorhizobium meliloti imb b-7411 для одержання бактеріального добрива під люцерну

Завантаження...

Номер патенту: 111391

Опубліковано: 25.04.2016

Автори: Коць Сергій Ярославович, Воробей Надія Анатоліївна

МПК: C12N 1/20, C12R 1/01, C05F 11/08 ...

Мітки: sinorhizobium, бактерій, b-7411, люцерну, добрива, бактеріального, одержання, meliloti, штам

Формула / Реферат:

Штам бактерій Sinorhizobium meliloti ІМВ В-7411 для одержання бактеріального добрива під люцерну.

Спосіб одержання поверхнево-активних речовин

Завантаження...

Номер патенту: 111047

Опубліковано: 10.03.2016

Автори: Пирог Тетяна Павлівна, Савенко Інга Володимирівна, Павлюковець Ірина Юріївна

МПК: C12N 1/20, C12P 1/04, C12R 1/01 ...

Мітки: поверхнево-активних, спосіб, речовин, одержання

Формула / Реферат:

Спосіб одержання поверхнево-активних речовин, що включає культивування штаму Acinetohacter calcoaceticus IMB В-7241 на рідкому середовищі, що містить мінеральні солі, як джерело азоту і вуглецю - сечовину і пересмажену соняшникову олію відповідно, з використанням інокуляту, вирощеного на глюкозі, який відрізняється тим, що концентрація пересмаженої соняшникової олії становить 3,9-4,1 % (об'ємна частка), а сечовини - 0,95-1,05...

Спосіб визначення днк бактерій виду chlamydia abortus, chlamydia pecorum, chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу р (rnase p rna)

Завантаження...

Номер патенту: 110546

Опубліковано: 12.01.2016

Автори: Цівенко Тетяна Михайлівна, Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: C12R 1/01, C12Q 1/68

Мітки: ланцюговий, chlamydia, ампліфікації, виду, rnase, psittaci, реакції, фрагмента, гена, бактерій, визначення, pecorum, полімеразній, ендорибонуклеазу, шляхом, abortus, спосіб, днк, кодує

Формула / Реферат:

Спосіб визначення ДНК бактерій виду Chlamydia abortus, Chlamydia pecorum, Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу Р (RNase Р RNA), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки фрагмента гена RNase Р RNA здійснюють за допомогою пари праймерів: прямого:CHCPF:5`-GGAGAAACTCCAGGGGCCGT-3` та зворотного:...

Консорціум мікроорганізмів для біоремедіації, суміш для біоремедіації та їх застосування для видалення забруднюючих речовин з ґрунту

Завантаження...

Номер патенту: 110449

Опубліковано: 25.12.2015

Автори: Коморовская Іга, Бощик-Малешак Ханка, Поповская Магдалена

МПК: B09C 1/10, C12R 1/06, C12R 1/01 ...

Мітки: суміш, біоремедіації, видалення, застосування, мікроорганізмів, речовин, ґрунту, консорціум, забруднюючих

Формула / Реферат:

1. Консорціум мікроорганізмів для біоремедіації, який містить штам 2L Stenotrophomonas sp., штам 5L Stenotrophomonas sp., штам 6L Stenotrophomonas sp., штам 3N Stenotrophomonas sp., штам 4P Achromobacter sp., штам 1N Arthrobacter sp., штам 2N Brevundimonas sp., штам 5N Brevundimonas sp., штам 6N Brevundimonas sp., штам 3G Pseudomonas sp. та штам 4G Pseudomonas sp.,...

Спосіб визначення днк бактерій chlamydia felis у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр)

Завантаження...

Номер патенту: 109489

Опубліковано: 25.08.2015

Автори: Почерняєв Костянтин Федорович, Цівенко Тетяна Михайлівна, Ксьонз Ігор Миколайович

МПК: C12Q 1/68, C12R 1/01

Мітки: ампліфікації, фрагменту, головного, спосіб, полімеразній, реакції, днк, визначення, гена, мембрани, ланцюговий, chlamydia, білка, felis, момр, шляхом, бактерій

Формула / Реферат:

Спосіб визначення ДНК збудника хламідійних інфекцій домашніх котів у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки ДНК МОМР бактерії Chlamydia felis здійснюють з використанням пари праймерів: прямого CHFMF 5'-GCAGCTTCTGGAACTGCAAGC-3' та зворотного CHFMR 5'-GGCGАААТСAGTTCCTGCAAGА-3' з одержанням...

Пробіотична композиція для застосування в лікуванні запалення кишечнику

Завантаження...

Номер патенту: 109123

Опубліковано: 27.07.2015

Автори: Еспадалер Масо Хорді, Куньє Кастельяна Хорді

МПК: A61K 35/747, A61P 1/06, A61K 35/744 ...

Мітки: композиція, кишечнику, запалення, застосування, пробіотична, лікуванні

Формула / Реферат:

1. Композиція, що містить ефективну кількість щонайменше одного штаму, який вибраний з групи, яка складається з Lactobacillus plantarum, депонованого в Іспанській Колекції Типових Культур під номером доступу CECT 7484, Lactobacillus plantarum, депонованого в Іспанській Колекції Типових Культур під номером доступу CECT 7485 і Pediococcus acidilactici, депонованого в Іспанській Колекції Типових Культур...

Спосіб моделювання колітів у тварин з використанням сульфатвідновлювальних бактерій – індукторів виразок товстого кишечника

Завантаження...

Номер патенту: 99480

Опубліковано: 10.06.2015

Автори: Кушкевич Іван Васильович, Влізло Василь Васильович, Кушкевич Мар'яна Василівна

МПК: G09B 23/28, C12R 1/01

Мітки: індукторів, спосіб, колітів, сульфатвідновлювальних, моделювання, тварин, кишечника, бактерій, товстого, виразок, використанням

Формула / Реферат:

Спосіб моделювання колітів у тварин з використанням бактерій - індукторів виразок товстого кишечника, який відрізняється тим, що для створення виразок товстого кишечника використовують сульфатвідновлювальні бактерії, які продукують гідроген сульфід і спричиняють захворювання з подальшим утворенням виразок.

Штам бактерій photobacterium phosphoreum sq3 imb-7071 як тест-культура для визначення біологічної дії електромагнітного випромінювання

Завантаження...

Номер патенту: 96184

Опубліковано: 26.01.2015

Автори: Громозова Олена Миколаївна, Грецький Ігор Олександрович, Підгорський Валентин Степанович, Зелена Любов Борисівна, Кацев Андрій Мойсейович

МПК: C12N 1/20, C12R 1/01

Мітки: photobacterium, бактерій, випромінювання, дії, штам, визначення, phosphoreum, біологічно, електромагнітного, тест-культура, imb-7071

Формула / Реферат:

Штам бактерій Photobacterium phosphoreum Sq3 IMB 7071 як тест-культура для визначення біологічної дії широкого спектра електромагнітного випромінювання, депонований у депозитарії Інституту мікробіології і вірусології ім. Д.К.Заболотного НАН України під № IMB B-7071.

Спосіб виробництва бурштинової кислоти з використанням бактеріального штаму з дерегульованою ферментною активністю ендогенної піруват-форміат-ліази

Завантаження...

Номер патенту: 105784

Опубліковано: 25.06.2014

Автори: Раддатц Аліне, Гурскі Ханс, Холльманн Раян, Абендрот Грегорі фон, Шрьодер Хартвіг, Хефнер Штефан, Ернст Хансгеорг

МПК: C12P 7/46, C12N 1/32, C12P 17/10 ...

Мітки: дерегульованою, спосіб, бурштинової, активністю, ендогенної, бактеріального, піруват-форміат-ліази, виробництва, використанням, штаму, кислоти, ферментною

Формула / Реферат:

1. Бактеріальний штам, що походить від мікроорганізму родини Pasteurellaceae, здатний використовувати гліцерин як джерело вуглецю для ферментаційного одержання бурштинової кислоти, причому вищезгаданий штам є генетично модифікованим таким чином, щоб включати дерегулювання ферментної активності ендогенної піруват-форміат-ліази, вищезгадана ферментна активність піруват-форміат-ліази знижується або вимикається.2. Штам за одним з...

Спосіб одержання поверхнево-активних речовин

Завантаження...

Номер патенту: 105711

Опубліковано: 10.06.2014

Автори: Мащенко Оксана Юріївна, Шулякова Марія Олександрівна, Пирог Тетяна Павлівна

МПК: C12R 1/01, C12N 1/20, C12P 1/04 ...

Мітки: поверхнево-активних, одержання, спосіб, речовин

Формула / Реферат:

Спосіб одержання поверхнево-активних речовин, що включає культивування Rhodococcus erythropolis IMB Ас-5017 на рідкому середовищі, що містить мінеральні солі і джерело вуглецю і енергії, який відрізняється тим, що як джерело вуглецю та енергії використовують суміш гексадекану і гліцерину у молярному співвідношенні 1:7, а концентрація гексадекану і гліцерину становить 0,59-0,61 об. % і 0,83-0,85 об.% відповідно.

Штам бактерій azospirillum brasilense для інокуляції насіння тритикале ярого

Завантаження...

Номер патенту: 104212

Опубліковано: 10.01.2014

Автори: Надкернична Олена Володимирівна, Шаховніна Олена Олександрівна, Ушакова Маргарита Анатоліївна

МПК: C12R 1/01, C05F 11/08, C12N 1/20 ...

Мітки: інокуляції, ярого, brasilense, насіння, бактерій, штам, тритікале, azospirillum

Формула / Реферат:

Штам бактерій Azospirillum brasilense, призначений для інокуляції насіння тритикале ярого, депонований в Депозитарії Інституту мікробіології і вірусології НАН України за реєстраційним номером Azospirillum brasilense IMB В-7317.

Спосіб вирощування сої

Завантаження...

Номер патенту: 103991

Опубліковано: 25.12.2013

Автори: Надкернична Олена Володимирівна, Вовколуп Наталія Володимирівна, Медвідь Тамара Олексіївна, Власюк Оксана Степанівна, Крутило Дмитро Валерійович, Дерев'янський Віктор Петрович

МПК: A01N 63/02, C12N 1/20, A01P 1/00 ...

Мітки: вирощування, сої, спосіб

Формула / Реферат:

Спосіб вирощування сої із застосуванням мікробного препарату, який відрізняється тим, що перед посадкою насіння сої сорту Легенда обробляють бактеріальним штамом Bradyrhizobium japonicum IМВ В-7200 з подальшим обприскуванням посівів сої у фазі утворення бобів біопрепаратом Кладостим-1 у кількості 100 мл/мг з використанням робочої рідини у кількості 300 л/га, де перед посівом насіння сої в ґрунт вносять мінеральні добрива...

Спосіб одержання поверхнево-активних речовин

Завантаження...

Номер патенту: 103817

Опубліковано: 25.11.2013

Автори: Шулякова Марія Олександрівна, Пирог Тетяна Павлівна

МПК: C12R 1/01, C12P 1/04, C12N 1/20 ...

Мітки: спосіб, одержання, поверхнево-активних, речовин

Формула / Реферат:

Спосіб одержання поверхнево-активних речовин, який включає культивування Rhodococcus erythropolis IMB Ас-5017 на рідкому середовищі, що містить мінеральні солі, джерело вуглецю і енергії, а також внесення у середовище на початку стаціонарної фази росту фумарату натрію масовою часткою 0,2 %, який відрізняється тим, що після добавлення фумарату рН підтримують на рівні 8,0-8,2 періодичним підкисленням розчином лимонної кислоти.

Вакцина для собак проти хвороби лайма

Завантаження...

Номер патенту: 99719

Опубліковано: 25.09.2012

Автори: Васмеуен Террі Л., Каллістер Стівен М., Лафльор Ронда

МПК: C12N 1/20, A61P 33/00, A61K 39/02 ...

Мітки: вакцина, собак, хвороби, лайма

Формула / Реферат:

1. Композиція вакцини для собак проти хвороби Лайма, яка містить імунологічно ефективну кількість організмів першого штаму геновидів борелій та імунологічно ефективну кількість організмів другого штаму геновидів борелій; де організми вказаного другого штаму експресують на свої поверхні OspA антиген, OspB антиген або експресують обидва - OspA та OspB антигени; та де введення вказаної вакцини собаці викликає вироблення значних рівнів антитіл...

Засіб із властивістю формування клітинного імунітету проти mycobacterium tuberculosis h37 rv, спосіб його отримання (варіанти), рекомбінантний штам і засіб для діагностики туберкульозу

Завантаження...

Номер патенту: 96488

Опубліковано: 10.11.2011

Автор: Кіслічкін Ніколай Ніколаєвіч

МПК: A61K 39/04, C12N 1/21, C12P 21/02 ...

Мітки: імунітету, tuberculosis, клітинного, варіанти, отримання, рекомбінантний, спосіб, формування, mycobacterium, властивістю, штам, діагностики, засіб, туберкульозу

Формула / Реферат:

1. Рекомбінантний штам 2-9XL Acinetobacter johnsonii VKPM-9312 - продуцент видоспецифічного глікопротеїнового туберкульозного комплексу M. tuberculosis Н37 Rv (ТБ-антигену), депонований у ВКПМ ФГУП ДержНДІгенетика.2. Спосіб отримання видоспецифічного глікопротеїнового туберкульозного комплексу Mycobacterium tuberculosis H37 Rv (ТБ-антигену), який відрізняється тим, що культуру рекомбінантного штаму 2-9XL Acinetobacter johnsonii...

Спосіб одержання поверхнево-активних речовин

Завантаження...

Номер патенту: 63961

Опубліковано: 25.10.2011

Автори: Пирог Тетяна Павлівна, Квятківська Ірина Володимирівна, Конон Анастасія Дмитрівна

МПК: C12R 1/01, C12N 1/02

Мітки: речовин, одержання, поверхнево-активних, спосіб

Формула / Реферат:

Спосіб одержання поверхнево-активних речовин, що включає культивування Acinetobacter calcoaceticus ІMB В-7241 на рідкому середовищі, що містить мінеральні солі і 2 % етанолу як джерела вуглецю і енергії, який відрізняється тим, що як посівний матеріал використовують культуру із стаціонарної фази росту, вирощену на середовищі з етанолом і 0,1-0,5 мМ Сu2+.

Ферментовані харчові продукти, що містять штами пробіотиків, і спосіб їх отримання

Завантаження...

Номер патенту: 96271

Опубліковано: 25.10.2011

Автори: Дебрю Франсуа, Блашон Жан-Люк, Тессьє Філіпп, Терраньо Люк, Ерве Стефан

МПК: A23C 9/12, A23L 1/211, A23C 9/127 ...

Мітки: містять, штами, продукти, ферментовані, спосіб, пробіотиків, харчові, отримання

Формула / Реферат:

1. Нетвердий ферментований харчовий продукт, що містить закваски, що містять молочнокислі бактерії, що включають одну або більше бактерій роду Lactobacillus spp., які вибрані з Lactobacillus delbrueckii bulgaricus і/або Lactobacillus casei, і/або Lactobacillus reuteri, і/або Lactobacillus...

Ферментовані харчові продукти, які містять пробіотичні штами, і спосіб їх отримання

Завантаження...

Номер патенту: 96270

Опубліковано: 25.10.2011

Автори: Форі Жан-Мішель, Терраньо Люк, Тессьє Філіпп, Ерве Стефан, Дебрю Франсуа

МПК: A23L 1/211, A23C 9/12, A23C 9/127 ...

Мітки: містять, спосіб, штами, пробіотичні, ферментовані, харчові, отримання, продукти

Формула / Реферат:

1. Застосування щонайменше однієї сірковмісної амінокислоти, що вибрана з цистеїну або метіоніну, в загальній концентрації від приблизно 5 до приблизно 30 мг/л у вільній формі, і заквасок, що містять молочнокислі бактерії, що вибрані з однієї або декількох бактерій роду Lactobacillus spp. і/або бактерій типу Lactococcus cremoris, і/або Streptococcus thermophilus, і/або Lactococcus...

Мікроорганізми як носії нуклеотидних послідовностей, що кодують антигени та білкові токсини, спосіб їх одержання та застосування

Завантаження...

Номер патенту: 94974

Опубліковано: 25.06.2011

Автори: Рапп Ульф-Р., Гентшев Івайло, Гебель Вернер, Фенштерле Йоахім

МПК: A61K 39/385, A61K 39/112, A61K 39/108 ...

Мітки: нуклеотидних, послідовностей, спосіб, кодують, мікроорганізми, антигени, одержання, носії, токсини, білкові, застосування

Формула / Реферат:

1. Мікроорганізм як носій нуклеотидних послідовностей, що кодують антигени та білкові токсини, який включає наступні компоненти:            (I) щонайменше одну нуклеотидну послідовність, що кодує щонайменше один повний або частковий антиген з щонайменше одного білка дикого типу або мутантного білка;             (II) щонайменше одну нуклеотидну послідовність, що кодує щонайменше один білковий токсин та/або щонайменше одну...

Спосіб лікування негоспітальних пневмоній у дітей раннього віку

Завантаження...

Номер патенту: 58314

Опубліковано: 11.04.2011

Автори: Сміян Олександр Іванович, Васильєва Олена Геннадіївна

МПК: A61K 35/74, A61P 31/04, A61P 11/12 ...

Мітки: дітей, лікування, спосіб, раннього, віку, пневмоній, негоспітальних

Формула / Реферат:

1. Спосіб лікування негоспітальних пневмоній у дітей раннього віку, що включає призначення комплексної терапії, яка містить антибактеріальні, муколітичні, жарознижуючі, імуномодулюючі препарати, який відрізняється тим, що додатково призначають пробіотичний препарат, до складу якого входить збалансований комплекс вітамінів В1 і В6, бактерії Lactobaillus GG та Bifidobacterium lactis.2. Спосіб за п. 1, який відрізняється тим, що як...

Авірулентний ізолят lawsonia intracellularis європейського походження, вакцини для імунізації тварин, застосування заявленого авірулентного ізоляту lawsonia intracellularis як вакцини, спосіб одержання вакцини,

Завантаження...

Номер патенту: 87665

Опубліковано: 10.08.2009

Автори: Кроулл Джеремі Дж., Руфф Майкл Б., Ніттел Джеффрі П.

МПК: A61B 10/00, A61K 39/02, A61K 35/16 ...

Мітки: авірулентний, одержання, походження, спосіб, lawsonia, вакцини, застосування, авірулентного, ізолят, імунізації, ізоляту, intracellularis, заявленого, тварин, європейського

Формула / Реферат:

1. Авірулентний ізолят Lawsonia intracellularis, де авірулентний ізолят являє собою ізолят Lawsonia intracellularis, депонований під реєстраційним номером ATCC PTA-4926, або будь-який авірулентний ізолят Lawsonia intracellularis європейського походження, який відрізняється тим, що зазначений авірулентний Lawsonia intracellularis не виділяється з фекаліями на 14 день після...

Штам бактерій bradyrhizobium japonicum для одержання бактеріального добрива під сою

Завантаження...

Номер патенту: 85943

Опубліковано: 10.03.2009

Автори: Крутило Дмитро Валерійович, Надкернична Олена Володимирівна, Горбань Віра Петрівна, Ковалевська Тамара Михайлівна

МПК: C12R 1/01, C12N 1/20, C05F 11/08 ...

Мітки: japonicum, штам, бактерій, добрива, одержання, bradyrhizobium, сою, бактеріального

Формула / Реферат:

Штам бактерій Bradyrhizobium japonicum, депонований в Депозитарії Інституту мікробіології і вірусології НАН України за номером IMB В-7200, призначений для виготовлення бактеріального добрива під сою.

Інокулянт для підвищення продуктивності сої

Завантаження...

Номер патенту: 85089

Опубліковано: 25.12.2008

Автори: Іутинська Галина Олександрівна, ТИТОВА Людмила Вячеславівна, Леонова Наталія Осипівна, Антипчук Адель Федорівна

МПК: C05F 11/08, C12R 1/01, C12N 1/20 ...

Мітки: сої, підвищення, продуктивності, інокулянт

Формула / Реферат:

Інокулянт для підвищення продуктивності сої, який відрізняється тим, що як біоагент він містить гомологічні штами Bradyrhizobium japonicum 69ч або Bradyrhizobium japonicum 10к, які зберігаються в Депозитарії Інституту мікробіології і вірусології НАН України під реєстраційними номерами IMB В-7167 та IMB В-7205 відповідно, та є комплементарними до широкого спектра сучасних сортів сої, мають пектиназну та азотфіксувальну...

Спосіб одержання амідів з використанням мікроорганізмів видів rhodococcus

Завантаження...

Номер патенту: 83654

Опубліковано: 11.08.2008

Автори: Робінз Карен Трейсі, Нагасава Тору

МПК: C12N 9/78, C12P 13/02, C12N 1/20 ...

Мітки: видів, спосіб, одержання, rhodococcus, мікроорганізмів, амідів, використанням

Формула / Реферат:

1. Спосіб одержання амідів, який відрізняється тим, що нітрил, який застосовують як субстрат, перетворюють на відповідний амід з використанням мікроорганізмів видів Rhodococcus GF270 і Rhodococcus GF376, які депоновані під реєстраційними номерами DSM 12211 і DSM 12175 відповідно, а також їх функціонально еквівалентних мутантів, які мають здатність перетворювати нітрил на амід, екстрактів ферментів із цих мікроорганізмів.2. Спосіб за...

Штам бактерій bradyrhizobium japonicum t66 для одержання бактеріального добрива під сою

Завантаження...

Номер патенту: 83298

Опубліковано: 25.06.2008

Автори: Коць Сергій Ярославович, Маліченко Світлана Марківна, Воробей Надія Анатоліївна, Даценко Василь Кузьмович

МПК: C05F 11/08, C12R 1/01, C12N 1/20 ...

Мітки: бактеріального, бактерій, одержання, добрива, сою, штам, bradyrhizobium, japonicum

Формула / Реферат:

Штам бактерій Bradyrhizobium japonicum T66, депонований у Депозитарії мікроорганізмів Інституту мікробіології і вірусології НАН України під реєстраційним номером IMB B-7194, для одержання бактеріального добрива під сою.

Штам бактерій rhodococcus erythropolis ek-1 – продуцент поверхнево-активних речовин

Завантаження...

Номер патенту: 77345

Опубліковано: 15.11.2006

Автори: Ігнатенко Сергій Вікторович, Пирог Тетяна Павлівна, Волошина Ірина Миколаївна

МПК: C12R 1/01, C12N 1/20, C12P 1/04 ...

Мітки: rhodococcus, поверхнево-активних, бактерій, речовин, продуцент, erythropolis, штам

Формула / Реферат:

Штам бактерій Rhodococcus erythropolis EK-1 1MB Ac-5017 - продуцент поверхнево-активних речовин.

Спосіб стабільного безперервного вироблення етанолу

Завантаження...

Номер патенту: 76117

Опубліковано: 17.07.2006

Автори: Ко Чінг-Ван, Арора Дінеш К., Уікстром Карл В., Клосен Едгар К., Гадді Джеймз Л., Філліпс Джон Рандалл, Базу Рахул

МПК: C12N 1/18, C12M 1/04, C12P 7/06 ...

Мітки: етанолу, спосіб, безперервного, вироблення, стабільного

Формула / Реферат:

1. Спосіб стабільного безперервного вироблення етанолу шляхом анаеробної бактеріальної ферментації газоподібного субстрату, що включає:культивування в ферментаційному бiореакторi бактерій Clostridium ljungdahlii, які здатні виробляти етанол, в рідкому поживному середовищі при рН близько 5,5 або менше;подачу в згаданий бiореактор газоподібного субстрату, що містить монооксид вуглецю;подачу в згаданий...

Спосіб одержання пробіотика “симбітер-м”

Завантаження...

Номер патенту: 67660

Опубліковано: 15.03.2006

Автори: Димент Галина Семенівна, Потребчук Олена Петрівна, Товкачевська Людмила Дмитрівна, Янковський Дмитро Станіславович

МПК: A61K 35/74, A23C 9/127, A61P 31/04 ...

Мітки: симбітер-м, пробіотика, спосіб, одержання

Формула / Реферат:

1. Одноразовий медичний шприц, який містить корпус з наконечником з голкою і, у середині якого розміщений поршень і шток, який відрізняється тим, що шприц оснащений вузлом з'єднання робочої камери шприца з атмосферою і виконаний в вигляді конусного загостреного стержню, жорстко закріпленого на торці поршню, який має можливість взаємодії з мембраною, установленою на торці наконечника, яка контактує з атмосферою.2. Шприц за п. 1, який...