C12R 1/01 — бактерії або актиноміцети

Спосіб індикації днк бактерії chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 123070

Опубліковано: 12.02.2018

Автори: Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович, Корнієнко Марина Володимирівна

МПК: C12R 1/01, A61K 39/118, C12Q 1/68 ...

Мітки: мембрани, головного, ампліфікації, бактерії, реакції, білка, видової, момр, гена, chlamydia, днк, шляхом, спосіб, індикації, диференціації, avium, фрагменту, полімеразній, ланцюговий

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia avium здійснюють за допомогою пари праймерів: прямого: ChAvMOMPL: 5' - TTCTGGTGATCCTTGCGACC-3' та зворотного: ChAvMOMPR: 5'- GCTCCTAAAGTTGCACAACC - 3', з одержанням...

Бінарна композиція штамів bradyrhizobium japonicum 3 різною швидкістю росту для підвищення продуктивності сої

Завантаження...

Номер патенту: 114981

Опубліковано: 28.08.2017

Автор: Крутило Дмитро Валерійович

МПК: C12N 1/20, C12R 1/01, C05F 11/08 ...

Мітки: bradyrhizobium, різною, бінарна, композиція, продуктивності, japonicum, сої, швидкістю, штамів, підвищення, росту

Формула / Реферат:

Бінарна композиція штамів Bradyrhizobium japonicum з різною швидкістю росту для підвищення продуктивності сої, яка відрізняється тим, що містить два штами бульбочкових бактерій сої повільнорослий Bradyrhizobium japonicum B-7200 та інтенсивнорослий Bradyrhizobium japonicum B-7435 у співвідношенні 1:1.

Спосіб виявлення дезоксирибонуклеїнової кислоти (днк) бактерій cronobacter spp. (enterobacter sakazakii)

Завантаження...

Номер патенту: 118844

Опубліковано: 28.08.2017

Автори: Моня Юлія Іванівна, Коростіль Сергій Олексійович, Бергілевич Олександра Миколаївна, Терьохіна Олена Вікторівна, Касянчук Вікторія Вікторівна, Дерябін Олег Миколайович

МПК: C12R 1/01, C12Q 1/68

Мітки: спосіб, cronobacter, виявлення, бактерій, дезоксирибонуклеїнової, кислоти, днк, enterobacter, sakazakii

Формула / Реферат:

Спосіб виявлення дезоксирибонуклеїнової кислоти (ДНК) бактерій Cronobacter spp. (Enterobacter sakazakii), що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) за допомогою мультиплексного варіанту полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно синтезовані олігонуклеотидні праймери, які є специфічними фрагментами до гену 16S rRNA, з наступною...

Спосіб індикації днк бактерії chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117100

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: C12R 1/01, C12Q 1/68

Мітки: днк, індикації, фрагмента, бактерії, диференціації, chlamydia, головного, шляхом, білка, реакції, видової, ампліфікації, спосіб, полімеразній, ланцюговий, мембрани, гена, pecorum, момp

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia pecorum здійснюють за допомогою пари праймерів: прямого: ChPecMOMPL 5'-TCCAATACGCACAATCGAAA-3' та зворотного: ChPecMOMPR 5'-GTAAGACAACGCTGCACCAA-3', з одержанням...

Спосіб індикації днк бактерії chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117099

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: C12R 1/01, C12Q 1/68

Мітки: ланцюговий, білка, момp, гена, індикації, ампліфікації, головного, реакції, chlamydia, полімеразній, шляхом, диференціації, мембрани, видової, спосіб, бактерії, днк, фрагмента

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia suis здійснюють за допомогою пари праймерів: прямого: ChSuMOMPL: 5'- TTCTTTGCAATGCTGCTGAA-3' та зворотного: ChSuMOMPR: 5'- ATCAAAGCTTGCTCGAGACC-3', з одержанням...

Спосіб індикації днк бактерії chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 117097

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: C12Q 1/68, C12R 1/01

Мітки: шляхом, спосіб, диференціації, момр, днк, мембрани, chlamydia, psittaci, видової, реакції, індикації, головного, ланцюговий, гена, полімеразній, білка, фрагмента, бактерії, ампліфікації

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia psittaci здійснюють за допомогою пари праймерів: прямого: ChPsMOMPL: 5'-GCACTATGTGGGAAGGTGCT-3' та зворотного: ChPsMOMPR: 5'-CCATTTGCTTCTGGCTGATT-3', з одержанням...

Спосіб індикації днк бактерії chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117091

Опубліковано: 12.06.2017

Автори: Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна

МПК: C12R 1/01, C12Q 1/68

Мітки: ампліфікації, спосіб, білка, полімеразній, видової, шляхом, ланцюговий, головного, chlamydia, гена, диференціації, мембрани, фрагмента, момp, бактерії, індикації, днк, abortus, реакції

Формула / Реферат:

Спосіб індикації ДНК бактерій Chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР) для її видової диференціації, який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia abortus здійснюють за допомогою пари праймерів: прямого: ChAbMOMPL: 5'-GGATAGACCCAACATCGCTT-3' та зворотного: ChAbMOMPR:...

Спосіб отримання культури “бородатих” коренів рослин artemisia dracunculus l.

Завантаження...

Номер патенту: 116312

Опубліковано: 10.05.2017

Автори: Дробот Катерина Олександрівна, Дуплій Володимир Павлович, Матвєєва Надія Анатоліївна, Шаховський Анатолій Михайлович

МПК: A01H 4/00, C12N 1/00, C12N 1/20 ...

Мітки: artemisia, коренів, отримання, спосіб, рослин, dracunculus, бородатих, культури

Формула / Реферат:

Спосіб отримання культури "бородатих" коренів рослин Artemisia dracunculus L., який включає підготовку суспензії Agrobacterium rhizogenes; відокремлення листків від асептичних рослин; поранення листових експлантів; інокуляцію експлантів суспензією агробактерій; кокультивування експлантів із A. rhizogenes на базовому середовищі; елімінацію агробактерій та індукцію "бородатих" коренів на базовому середовищі, доповненому...

Спосіб якісного та кількісного визначення видового складу багатокомпонентних бактеріальних препаратів за допомогою специфічних праймерів методом полімеразної ланцюгової реакції реального часу

Завантаження...

Номер патенту: 115774

Опубліковано: 25.04.2017

Автори: Коробка Вадим Леонідович, Димент Галина Семенівна, Літовченко Олександр Вікторович, Шевченко Тетяна Вікторівна, Янковський Дмитро Станіславович, Кітам Володимир Олегович, Шевченко Любов Миколаївна

МПК: C12R 1/01, C12N 1/20

Мітки: праймерів, часу, ланцюгової, полімеразної, багатокомпонентних, визначення, бактеріальних, реакції, складу, реального, препаратів, специфічних, допомогою, якісного, спосіб, видового, кількісного, методом

Формула / Реферат:

Спосіб якісного та кількісного визначення видового складу багатокомпонентного бактеріального препарату, щомістить представників родів Bifidobacterium, Lactobacillus, Propionibacterium, Lactococcus, Streptococcus та Acetobacter, за допомогою специфічних праймерів методом полімеразної ланцюгової реакції в режимі реального часу, який відрізняється тим, що визначають склад бактеріального препарату на рівні видів Lactobacillus acidophilus,...

Спосіб вирощування соризу

Завантаження...

Номер патенту: 110299

Опубліковано: 10.10.2016

Автори: Сучек Микола Миколайович, Молдован Віктор Григорович, Дерев'янський Віктор Петрович

МПК: C12N 1/20, A01P 1/00, A01N 63/02 ...

Мітки: вирощування, спосіб, сорізу

Формула / Реферат:

Спосіб вирощування соризу для підвищення продуктивності культури, який відрізняється тим, що насіння соризу сорту Титан перед сівбою обробляють Флавобактерином та обприскують посіви у фазі 4-6 листків Кладостимом - 100 мл/га з використанням 200 л/га робочої рідини на фоні заробки сидеральних добрив у ґрунт.

Спосіб одержання поверхнево-активних речовин

Завантаження...

Номер патенту: 111501

Опубліковано: 10.05.2016

Автори: Шулякова Марія Олександрівна, Антонюк Світлана Ігорівна, Антонюк Ніна Олександрівна, Пирог Тетяна Павлівна

МПК: C12N 1/00, C12R 1/21, C12R 1/01 ...

Мітки: спосіб, поверхнево-активних, речовин, одержання

Формула / Реферат:

Спосіб одержання поверхнево-активних речовин включає культивування Acinetobacter calcoaceticus IMB В-7241 на рідкому середовищі, що містить мінеральні солі, як джерело азоту - сечовину, як джерело вуглецевого живлення - технічний гліцерин, 0,16 мкмоль/л сульфату міді і 38 мкмоль/л сульфату цинку, який відрізняється тим, що концентрація сечовини становить 0,7-0,9 г/л.

Спосіб одержання поверхнево-активних речовин

Завантаження...

Номер патенту: 111498

Опубліковано: 10.05.2016

Автори: Савенко Інга Володимирівна, Конон Анастасія Дмитрівна, Пирог Тетяна Павлівна

МПК: C12R 1/20, C12R 1/01, C12N 1/20 ...

Мітки: одержання, речовин, поверхнево-активних, спосіб

Формула / Реферат:

Спосіб одержання поверхнево-активних речовин, що включає культивування штаму Acinetobacter calcoaceticus ІMB В-7241 на рідкому середовищі, що містить мінеральні солі і як джерело вуглецевого живлення пересмажену соняшникову олію (2 %, об'ємна частка), який відрізняється тим, що використовують 6-8 % посівного матеріалу, вирощеного на середовищі з глюкозою 0,8-1,0 %.

Штам бактерій sinorhizobium meliloti imb b-7411 для одержання бактеріального добрива під люцерну

Завантаження...

Номер патенту: 111391

Опубліковано: 25.04.2016

Автори: Воробей Надія Анатоліївна, Коць Сергій Ярославович

МПК: C05F 11/08, C12N 1/20, C12R 1/01 ...

Мітки: sinorhizobium, добрива, бактерій, штам, люцерну, meliloti, бактеріального, одержання, b-7411

Формула / Реферат:

Штам бактерій Sinorhizobium meliloti ІМВ В-7411 для одержання бактеріального добрива під люцерну.

Спосіб одержання поверхнево-активних речовин

Завантаження...

Номер патенту: 111047

Опубліковано: 10.03.2016

Автори: Пирог Тетяна Павлівна, Савенко Інга Володимирівна, Павлюковець Ірина Юріївна

МПК: C12N 1/20, C12R 1/01, C12P 1/04 ...

Мітки: спосіб, поверхнево-активних, одержання, речовин

Формула / Реферат:

Спосіб одержання поверхнево-активних речовин, що включає культивування штаму Acinetohacter calcoaceticus IMB В-7241 на рідкому середовищі, що містить мінеральні солі, як джерело азоту і вуглецю - сечовину і пересмажену соняшникову олію відповідно, з використанням інокуляту, вирощеного на глюкозі, який відрізняється тим, що концентрація пересмаженої соняшникової олії становить 3,9-4,1 % (об'ємна частка), а сечовини - 0,95-1,05...

Спосіб визначення днк бактерій виду chlamydia abortus, chlamydia pecorum, chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу р (rnase p rna)

Завантаження...

Номер патенту: 110546

Опубліковано: 12.01.2016

Автори: Ксьонз Ігор Миколайович, Цівенко Тетяна Михайлівна, Почерняєв Костянтин Федорович

МПК: C12R 1/01, C12Q 1/68

Мітки: визначення, бактерій, днк, abortus, chlamydia, фрагмента, rnase, полімеразній, psittaci, гена, ампліфікації, виду, кодує, реакції, ланцюговий, спосіб, pecorum, шляхом, ендорибонуклеазу

Формула / Реферат:

Спосіб визначення ДНК бактерій виду Chlamydia abortus, Chlamydia pecorum, Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу Р (RNase Р RNA), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки фрагмента гена RNase Р RNA здійснюють за допомогою пари праймерів: прямого:CHCPF:5`-GGAGAAACTCCAGGGGCCGT-3` та зворотного:...

Консорціум мікроорганізмів для біоремедіації, суміш для біоремедіації та їх застосування для видалення забруднюючих речовин з ґрунту

Завантаження...

Номер патенту: 110449

Опубліковано: 25.12.2015

Автори: Поповская Магдалена, Коморовская Іга, Бощик-Малешак Ханка

МПК: C12R 1/01, B09C 1/10, C12R 1/06 ...

Мітки: видалення, застосування, біоремедіації, речовин, суміш, консорціум, мікроорганізмів, забруднюючих, ґрунту

Формула / Реферат:

1. Консорціум мікроорганізмів для біоремедіації, який містить штам 2L Stenotrophomonas sp., штам 5L Stenotrophomonas sp., штам 6L Stenotrophomonas sp., штам 3N Stenotrophomonas sp., штам 4P Achromobacter sp., штам 1N Arthrobacter sp., штам 2N Brevundimonas sp., штам 5N Brevundimonas sp., штам 6N Brevundimonas sp., штам 3G Pseudomonas sp. та штам 4G Pseudomonas sp.,...

Спосіб визначення днк бактерій chlamydia felis у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр)

Завантаження...

Номер патенту: 109489

Опубліковано: 25.08.2015

Автори: Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович, Цівенко Тетяна Михайлівна

МПК: C12Q 1/68, C12R 1/01

Мітки: фрагменту, гена, chlamydia, реакції, визначення, felis, білка, днк, ланцюговий, полімеразній, головного, бактерій, мембрани, ампліфікації, момр, спосіб, шляхом

Формула / Реферат:

Спосіб визначення ДНК збудника хламідійних інфекцій домашніх котів у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки ДНК МОМР бактерії Chlamydia felis здійснюють з використанням пари праймерів: прямого CHFMF 5'-GCAGCTTCTGGAACTGCAAGC-3' та зворотного CHFMR 5'-GGCGАААТСAGTTCCTGCAAGА-3' з одержанням...

Пробіотична композиція для застосування в лікуванні запалення кишечнику

Завантаження...

Номер патенту: 109123

Опубліковано: 27.07.2015

Автори: Еспадалер Масо Хорді, Куньє Кастельяна Хорді

МПК: A61K 35/747, A61K 35/744, A61P 1/06 ...

Мітки: застосування, лікуванні, кишечнику, запалення, композиція, пробіотична

Формула / Реферат:

1. Композиція, що містить ефективну кількість щонайменше одного штаму, який вибраний з групи, яка складається з Lactobacillus plantarum, депонованого в Іспанській Колекції Типових Культур під номером доступу CECT 7484, Lactobacillus plantarum, депонованого в Іспанській Колекції Типових Культур під номером доступу CECT 7485 і Pediococcus acidilactici, депонованого в Іспанській Колекції Типових Культур...

Спосіб моделювання колітів у тварин з використанням сульфатвідновлювальних бактерій – індукторів виразок товстого кишечника

Завантаження...

Номер патенту: 99480

Опубліковано: 10.06.2015

Автори: Кушкевич Мар'яна Василівна, Влізло Василь Васильович, Кушкевич Іван Васильович

МПК: C12R 1/01, G09B 23/28

Мітки: сульфатвідновлювальних, товстого, виразок, моделювання, колітів, бактерій, тварин, кишечника, використанням, індукторів, спосіб

Формула / Реферат:

Спосіб моделювання колітів у тварин з використанням бактерій - індукторів виразок товстого кишечника, який відрізняється тим, що для створення виразок товстого кишечника використовують сульфатвідновлювальні бактерії, які продукують гідроген сульфід і спричиняють захворювання з подальшим утворенням виразок.

Штам бактерій photobacterium phosphoreum sq3 imb-7071 як тест-культура для визначення біологічної дії електромагнітного випромінювання

Завантаження...

Номер патенту: 96184

Опубліковано: 26.01.2015

Автори: Грецький Ігор Олександрович, Зелена Любов Борисівна, Громозова Олена Миколаївна, Кацев Андрій Мойсейович, Підгорський Валентин Степанович

МПК: C12R 1/01, C12N 1/20

Мітки: phosphoreum, дії, photobacterium, визначення, біологічно, бактерій, штам, випромінювання, електромагнітного, imb-7071, тест-культура

Формула / Реферат:

Штам бактерій Photobacterium phosphoreum Sq3 IMB 7071 як тест-культура для визначення біологічної дії широкого спектра електромагнітного випромінювання, депонований у депозитарії Інституту мікробіології і вірусології ім. Д.К.Заболотного НАН України під № IMB B-7071.

Спосіб виробництва бурштинової кислоти з використанням бактеріального штаму з дерегульованою ферментною активністю ендогенної піруват-форміат-ліази

Завантаження...

Номер патенту: 105784

Опубліковано: 25.06.2014

Автори: Холльманн Раян, Абендрот Грегорі фон, Раддатц Аліне, Гурскі Ханс, Хефнер Штефан, Ернст Хансгеорг, Шрьодер Хартвіг

МПК: C12P 7/46, C12P 17/10, C12N 1/32 ...

Мітки: бактеріального, дерегульованою, бурштинової, виробництва, використанням, штаму, ендогенної, ферментною, активністю, кислоти, піруват-форміат-ліази, спосіб

Формула / Реферат:

1. Бактеріальний штам, що походить від мікроорганізму родини Pasteurellaceae, здатний використовувати гліцерин як джерело вуглецю для ферментаційного одержання бурштинової кислоти, причому вищезгаданий штам є генетично модифікованим таким чином, щоб включати дерегулювання ферментної активності ендогенної піруват-форміат-ліази, вищезгадана ферментна активність піруват-форміат-ліази знижується або вимикається.2. Штам за одним з...

Спосіб одержання поверхнево-активних речовин

Завантаження...

Номер патенту: 105711

Опубліковано: 10.06.2014

Автори: Шулякова Марія Олександрівна, Мащенко Оксана Юріївна, Пирог Тетяна Павлівна

МПК: C12R 1/01, C12P 1/04, C12N 1/20 ...

Мітки: речовин, поверхнево-активних, спосіб, одержання

Формула / Реферат:

Спосіб одержання поверхнево-активних речовин, що включає культивування Rhodococcus erythropolis IMB Ас-5017 на рідкому середовищі, що містить мінеральні солі і джерело вуглецю і енергії, який відрізняється тим, що як джерело вуглецю та енергії використовують суміш гексадекану і гліцерину у молярному співвідношенні 1:7, а концентрація гексадекану і гліцерину становить 0,59-0,61 об. % і 0,83-0,85 об.% відповідно.

Штам бактерій azospirillum brasilense для інокуляції насіння тритикале ярого

Завантаження...

Номер патенту: 104212

Опубліковано: 10.01.2014

Автори: Надкернична Олена Володимирівна, Ушакова Маргарита Анатоліївна, Шаховніна Олена Олександрівна

МПК: C12R 1/01, C05F 11/08, C12N 1/20 ...

Мітки: бактерій, інокуляції, ярого, тритікале, azospirillum, штам, насіння, brasilense

Формула / Реферат:

Штам бактерій Azospirillum brasilense, призначений для інокуляції насіння тритикале ярого, депонований в Депозитарії Інституту мікробіології і вірусології НАН України за реєстраційним номером Azospirillum brasilense IMB В-7317.

Спосіб вирощування сої

Завантаження...

Номер патенту: 103991

Опубліковано: 25.12.2013

Автори: Медвідь Тамара Олексіївна, Крутило Дмитро Валерійович, Дерев'янський Віктор Петрович, Надкернична Олена Володимирівна, Власюк Оксана Степанівна, Вовколуп Наталія Володимирівна

МПК: A01P 1/00, C12N 1/20, A01N 63/02 ...

Мітки: сої, вирощування, спосіб

Формула / Реферат:

Спосіб вирощування сої із застосуванням мікробного препарату, який відрізняється тим, що перед посадкою насіння сої сорту Легенда обробляють бактеріальним штамом Bradyrhizobium japonicum IМВ В-7200 з подальшим обприскуванням посівів сої у фазі утворення бобів біопрепаратом Кладостим-1 у кількості 100 мл/мг з використанням робочої рідини у кількості 300 л/га, де перед посівом насіння сої в ґрунт вносять мінеральні добрива...

Спосіб одержання поверхнево-активних речовин

Завантаження...

Номер патенту: 103817

Опубліковано: 25.11.2013

Автори: Пирог Тетяна Павлівна, Шулякова Марія Олександрівна

МПК: C12R 1/01, C12N 1/20, C12P 1/04 ...

Мітки: поверхнево-активних, речовин, спосіб, одержання

Формула / Реферат:

Спосіб одержання поверхнево-активних речовин, який включає культивування Rhodococcus erythropolis IMB Ас-5017 на рідкому середовищі, що містить мінеральні солі, джерело вуглецю і енергії, а також внесення у середовище на початку стаціонарної фази росту фумарату натрію масовою часткою 0,2 %, який відрізняється тим, що після добавлення фумарату рН підтримують на рівні 8,0-8,2 періодичним підкисленням розчином лимонної кислоти.

Вакцина для собак проти хвороби лайма

Завантаження...

Номер патенту: 99719

Опубліковано: 25.09.2012

Автори: Васмеуен Террі Л., Лафльор Ронда, Каллістер Стівен М.

МПК: C12N 1/20, A61K 39/02, A61P 33/00 ...

Мітки: лайма, хвороби, вакцина, собак

Формула / Реферат:

1. Композиція вакцини для собак проти хвороби Лайма, яка містить імунологічно ефективну кількість організмів першого штаму геновидів борелій та імунологічно ефективну кількість організмів другого штаму геновидів борелій; де організми вказаного другого штаму експресують на свої поверхні OspA антиген, OspB антиген або експресують обидва - OspA та OspB антигени; та де введення вказаної вакцини собаці викликає вироблення значних рівнів антитіл...

Засіб із властивістю формування клітинного імунітету проти mycobacterium tuberculosis h37 rv, спосіб його отримання (варіанти), рекомбінантний штам і засіб для діагностики туберкульозу

Завантаження...

Номер патенту: 96488

Опубліковано: 10.11.2011

Автор: Кіслічкін Ніколай Ніколаєвіч

МПК: C12P 21/02, C12N 1/21, A61K 39/04 ...

Мітки: tuberculosis, варіанти, формування, туберкульозу, рекомбінантний, засіб, mycobacterium, діагностики, клітинного, отримання, штам, властивістю, спосіб, імунітету

Формула / Реферат:

1. Рекомбінантний штам 2-9XL Acinetobacter johnsonii VKPM-9312 - продуцент видоспецифічного глікопротеїнового туберкульозного комплексу M. tuberculosis Н37 Rv (ТБ-антигену), депонований у ВКПМ ФГУП ДержНДІгенетика.2. Спосіб отримання видоспецифічного глікопротеїнового туберкульозного комплексу Mycobacterium tuberculosis H37 Rv (ТБ-антигену), який відрізняється тим, що культуру рекомбінантного штаму 2-9XL Acinetobacter johnsonii...

Спосіб одержання поверхнево-активних речовин

Завантаження...

Номер патенту: 63961

Опубліковано: 25.10.2011

Автори: Пирог Тетяна Павлівна, Конон Анастасія Дмитрівна, Квятківська Ірина Володимирівна

МПК: C12N 1/02, C12R 1/01

Мітки: речовин, поверхнево-активних, одержання, спосіб

Формула / Реферат:

Спосіб одержання поверхнево-активних речовин, що включає культивування Acinetobacter calcoaceticus ІMB В-7241 на рідкому середовищі, що містить мінеральні солі і 2 % етанолу як джерела вуглецю і енергії, який відрізняється тим, що як посівний матеріал використовують культуру із стаціонарної фази росту, вирощену на середовищі з етанолом і 0,1-0,5 мМ Сu2+.

Ферментовані харчові продукти, що містять штами пробіотиків, і спосіб їх отримання

Завантаження...

Номер патенту: 96271

Опубліковано: 25.10.2011

Автори: Терраньо Люк, Ерве Стефан, Тессьє Філіпп, Дебрю Франсуа, Блашон Жан-Люк

МПК: A23L 1/211, A23C 9/127, A23C 9/12 ...

Мітки: пробіотиків, містять, отримання, штами, спосіб, ферментовані, продукти, харчові

Формула / Реферат:

1. Нетвердий ферментований харчовий продукт, що містить закваски, що містять молочнокислі бактерії, що включають одну або більше бактерій роду Lactobacillus spp., які вибрані з Lactobacillus delbrueckii bulgaricus і/або Lactobacillus casei, і/або Lactobacillus reuteri, і/або Lactobacillus...

Ферментовані харчові продукти, які містять пробіотичні штами, і спосіб їх отримання

Завантаження...

Номер патенту: 96270

Опубліковано: 25.10.2011

Автори: Форі Жан-Мішель, Дебрю Франсуа, Ерве Стефан, Тессьє Філіпп, Терраньо Люк

МПК: A23C 9/127, A23C 9/12, A23L 1/211 ...

Мітки: харчові, штами, отримання, спосіб, пробіотичні, містять, ферментовані, продукти

Формула / Реферат:

1. Застосування щонайменше однієї сірковмісної амінокислоти, що вибрана з цистеїну або метіоніну, в загальній концентрації від приблизно 5 до приблизно 30 мг/л у вільній формі, і заквасок, що містять молочнокислі бактерії, що вибрані з однієї або декількох бактерій роду Lactobacillus spp. і/або бактерій типу Lactococcus cremoris, і/або Streptococcus thermophilus, і/або Lactococcus...

Мікроорганізми як носії нуклеотидних послідовностей, що кодують антигени та білкові токсини, спосіб їх одержання та застосування

Завантаження...

Номер патенту: 94974

Опубліковано: 25.06.2011

Автори: Рапп Ульф-Р., Фенштерле Йоахім, Гебель Вернер, Гентшев Івайло

МПК: A61K 39/385, A61K 39/108, A61K 39/112 ...

Мітки: застосування, токсини, мікроорганізми, нуклеотидних, антигени, спосіб, носії, білкові, кодують, одержання, послідовностей

Формула / Реферат:

1. Мікроорганізм як носій нуклеотидних послідовностей, що кодують антигени та білкові токсини, який включає наступні компоненти:            (I) щонайменше одну нуклеотидну послідовність, що кодує щонайменше один повний або частковий антиген з щонайменше одного білка дикого типу або мутантного білка;             (II) щонайменше одну нуклеотидну послідовність, що кодує щонайменше один білковий токсин та/або щонайменше одну...

Спосіб лікування негоспітальних пневмоній у дітей раннього віку

Завантаження...

Номер патенту: 58314

Опубліковано: 11.04.2011

Автори: Сміян Олександр Іванович, Васильєва Олена Геннадіївна

МПК: A61P 31/04, A61K 35/74, A61P 11/12 ...

Мітки: раннього, спосіб, дітей, віку, лікування, негоспітальних, пневмоній

Формула / Реферат:

1. Спосіб лікування негоспітальних пневмоній у дітей раннього віку, що включає призначення комплексної терапії, яка містить антибактеріальні, муколітичні, жарознижуючі, імуномодулюючі препарати, який відрізняється тим, що додатково призначають пробіотичний препарат, до складу якого входить збалансований комплекс вітамінів В1 і В6, бактерії Lactobaillus GG та Bifidobacterium lactis.2. Спосіб за п. 1, який відрізняється тим, що як...

Авірулентний ізолят lawsonia intracellularis європейського походження, вакцини для імунізації тварин, застосування заявленого авірулентного ізоляту lawsonia intracellularis як вакцини, спосіб одержання вакцини,

Завантаження...

Номер патенту: 87665

Опубліковано: 10.08.2009

Автори: Руфф Майкл Б., Кроулл Джеремі Дж., Ніттел Джеффрі П.

МПК: A61K 35/16, A61B 10/00, A61K 39/02 ...

Мітки: авірулентного, вакцини, авірулентний, одержання, ізоляту, спосіб, intracellularis, тварин, імунізації, заявленого, ізолят, lawsonia, застосування, європейського, походження

Формула / Реферат:

1. Авірулентний ізолят Lawsonia intracellularis, де авірулентний ізолят являє собою ізолят Lawsonia intracellularis, депонований під реєстраційним номером ATCC PTA-4926, або будь-який авірулентний ізолят Lawsonia intracellularis європейського походження, який відрізняється тим, що зазначений авірулентний Lawsonia intracellularis не виділяється з фекаліями на 14 день після...

Штам бактерій bradyrhizobium japonicum для одержання бактеріального добрива під сою

Завантаження...

Номер патенту: 85943

Опубліковано: 10.03.2009

Автори: Крутило Дмитро Валерійович, Горбань Віра Петрівна, Надкернична Олена Володимирівна, Ковалевська Тамара Михайлівна

МПК: C12R 1/01, C12N 1/20, C05F 11/08 ...

Мітки: штам, добрива, bradyrhizobium, бактерій, одержання, japonicum, бактеріального, сою

Формула / Реферат:

Штам бактерій Bradyrhizobium japonicum, депонований в Депозитарії Інституту мікробіології і вірусології НАН України за номером IMB В-7200, призначений для виготовлення бактеріального добрива під сою.

Інокулянт для підвищення продуктивності сої

Завантаження...

Номер патенту: 85089

Опубліковано: 25.12.2008

Автори: Іутинська Галина Олександрівна, ТИТОВА Людмила Вячеславівна, Леонова Наталія Осипівна, Антипчук Адель Федорівна

МПК: C12R 1/01, C12N 1/20, C05F 11/08 ...

Мітки: сої, підвищення, інокулянт, продуктивності

Формула / Реферат:

Інокулянт для підвищення продуктивності сої, який відрізняється тим, що як біоагент він містить гомологічні штами Bradyrhizobium japonicum 69ч або Bradyrhizobium japonicum 10к, які зберігаються в Депозитарії Інституту мікробіології і вірусології НАН України під реєстраційними номерами IMB В-7167 та IMB В-7205 відповідно, та є комплементарними до широкого спектра сучасних сортів сої, мають пектиназну та азотфіксувальну...

Спосіб одержання амідів з використанням мікроорганізмів видів rhodococcus

Завантаження...

Номер патенту: 83654

Опубліковано: 11.08.2008

Автори: Нагасава Тору, Робінз Карен Трейсі

МПК: C12N 1/20, C12P 13/02, C12N 9/78 ...

Мітки: амідів, одержання, використанням, спосіб, мікроорганізмів, rhodococcus, видів

Формула / Реферат:

1. Спосіб одержання амідів, який відрізняється тим, що нітрил, який застосовують як субстрат, перетворюють на відповідний амід з використанням мікроорганізмів видів Rhodococcus GF270 і Rhodococcus GF376, які депоновані під реєстраційними номерами DSM 12211 і DSM 12175 відповідно, а також їх функціонально еквівалентних мутантів, які мають здатність перетворювати нітрил на амід, екстрактів ферментів із цих мікроорганізмів.2. Спосіб за...

Штам бактерій bradyrhizobium japonicum t66 для одержання бактеріального добрива під сою

Завантаження...

Номер патенту: 83298

Опубліковано: 25.06.2008

Автори: Воробей Надія Анатоліївна, Даценко Василь Кузьмович, Коць Сергій Ярославович, Маліченко Світлана Марківна

МПК: C12R 1/01, C05F 11/08, C12N 1/20 ...

Мітки: добрива, бактеріального, бактерій, bradyrhizobium, japonicum, одержання, штам, сою

Формула / Реферат:

Штам бактерій Bradyrhizobium japonicum T66, депонований у Депозитарії мікроорганізмів Інституту мікробіології і вірусології НАН України під реєстраційним номером IMB B-7194, для одержання бактеріального добрива під сою.

Штам бактерій rhodococcus erythropolis ek-1 – продуцент поверхнево-активних речовин

Завантаження...

Номер патенту: 77345

Опубліковано: 15.11.2006

Автори: Ігнатенко Сергій Вікторович, Пирог Тетяна Павлівна, Волошина Ірина Миколаївна

МПК: C12R 1/01, C12N 1/20, C12P 1/04 ...

Мітки: штам, erythropolis, бактерій, rhodococcus, продуцент, поверхнево-активних, речовин

Формула / Реферат:

Штам бактерій Rhodococcus erythropolis EK-1 1MB Ac-5017 - продуцент поверхнево-активних речовин.

Спосіб стабільного безперервного вироблення етанолу

Завантаження...

Номер патенту: 76117

Опубліковано: 17.07.2006

Автори: Клосен Едгар К., Арора Дінеш К., Ко Чінг-Ван, Уікстром Карл В., Філліпс Джон Рандалл, Гадді Джеймз Л., Базу Рахул

МПК: C12N 1/18, C12P 7/06, C12M 1/04 ...

Мітки: стабільного, спосіб, вироблення, безперервного, етанолу

Формула / Реферат:

1. Спосіб стабільного безперервного вироблення етанолу шляхом анаеробної бактеріальної ферментації газоподібного субстрату, що включає:культивування в ферментаційному бiореакторi бактерій Clostridium ljungdahlii, які здатні виробляти етанол, в рідкому поживному середовищі при рН близько 5,5 або менше;подачу в згаданий бiореактор газоподібного субстрату, що містить монооксид вуглецю;подачу в згаданий...

Спосіб одержання пробіотика “симбітер-м”

Завантаження...

Номер патенту: 67660

Опубліковано: 15.03.2006

Автори: Димент Галина Семенівна, Янковський Дмитро Станіславович, Потребчук Олена Петрівна, Товкачевська Людмила Дмитрівна

МПК: A61P 31/04, A23C 9/127, A61K 35/74 ...

Мітки: спосіб, симбітер-м, пробіотика, одержання

Формула / Реферат:

1. Одноразовий медичний шприц, який містить корпус з наконечником з голкою і, у середині якого розміщений поршень і шток, який відрізняється тим, що шприц оснащений вузлом з'єднання робочої камери шприца з атмосферою і виконаний в вигляді конусного загостреного стержню, жорстко закріпленого на торці поршню, який має можливість взаємодії з мембраною, установленою на торці наконечника, яка контактує з атмосферою.2. Шприц за п. 1, який...