C12Q 1/68 — використовують нуклеїнові кислоти

Спосіб індикації днк бактерії chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 123070

Опубліковано: 12.02.2018

Автори: Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: C12R 1/01, C12Q 1/68, A61K 39/118 ...

Мітки: полімеразній, фрагменту, avium, ланцюговий, гена, головного, мембрани, днк, спосіб, шляхом, бактерії, chlamydia, білка, диференціації, момр, реакції, видової, індикації, ампліфікації

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia avium здійснюють за допомогою пари праймерів: прямого: ChAvMOMPL: 5' - TTCTGGTGATCCTTGCGACC-3' та зворотного: ChAvMOMPR: 5'- GCTCCTAAAGTTGCACAACC - 3', з одержанням...

Спосіб визначення бацилярних збудників харчових отруєнь та псування харчових продуктів за генами токсичності

Завантаження...

Номер патенту: 122765

Опубліковано: 25.01.2018

Автори: Ямборко Ганна Валентинівна, Іваниця Володимир Олексійович, Пилипенко Людмила Миколаївна, Данілова Олена Іванівна, Пилипенко Інна Василівна, Капрельянц Леонід Вікторович

МПК: C12R 1/085, C12Q 1/68, C12N 15/62 ...

Мітки: продуктів, отруєнь, токсичності, бацилярних, збудникiв, харчових, псування, спосіб, визначення, генами

Формула / Реферат:

Спосіб визначення бацилярних збудників харчових отруєнь та псування харчових продуктів, що включає підготування дослідних зразків, виділення мікроорганізмів, виділення геномів ДНК попередньо виділених мікроорганізмів, проведення мультиплексної полімеразної ланцюгової реакції з використанням прямих і зворотних праймерів і електрофорез продуктів мультиплексної полімеразної ланцюгової реакції з використанням маркерів нуклеотидних фрагментів,...

Спосіб визначення еметогенних та ентеротоксигенних бацил в харчових продуктах

Завантаження...

Номер патенту: 122752

Опубліковано: 25.01.2018

Автори: Пилипенко Людмила Миколаївна, Ямборко Ганна Валентинівна, Пилипенко Інна Василівна, Ільєва Олена Сергіївна, Капрельянц Леонід Вікторович, Данілова Олена Іванівна, Іваниця Володимир Олексійович

МПК: C12Q 1/68, C12N 15/62, G01N 33/00 ...

Мітки: визначення, бацил, спосіб, ентеротоксигенних, продуктах, еметогенних, харчових

Формула / Реферат:

Спосіб визначення еметогенних та ентеротоксигенних бацил в харчових продуктах, що включає підготування дослідних зразків, відділення мікроорганізмів, виділення геномів ДНК попередньо відділених мікроорганізмів, проведення полімеразної ланцюгової реакції з використанням прямих і зворотних праймерів і електрофорез продуктів полімеразної ланцюгової реакції з використанням маркерів нуклеотидних фрагментів який відрізняється тим, що безпечність...

Спосіб визначення безпечності харчових продуктів за генами токсичності бацилярних збудників харчових отруєнь

Завантаження...

Номер патенту: 122751

Опубліковано: 25.01.2018

Автори: Пилипенко Людмила Миколаївна, Іваниця Володимир Олексійович, Пилипенко Інна Василівна, Данілова Олена Іванівна, Ямборко Ганна Валентинівна

МПК: C12Q 1/68, G01N 33/00, C12N 15/62 ...

Мітки: збудникiв, визначення, харчових, бацилярних, безпечності, спосіб, токсичності, генами, отруєнь, продуктів

Формула / Реферат:

Спосіб визначення безпечності харчових продуктів за генами токсичності бацилярних збудників харчових отруєнь, що включає підготування дослідних зразків, відділення мікроорганізмів, виділення геномів ДНК попередньо відділених мікроорганізмів, проведення полімеразної ланцюгової реакції з використанням прямих і зворотних праймерів і електрофорез продуктів полімеразної ланцюгової реакції з використанням маркерів нуклеотидних фрагментів, який...

Композиція та спосіб коригування систематичної похибки ампліфікації в множинних плр-реакціях

Завантаження...

Номер патенту: 115783

Опубліковано: 26.12.2017

Автори: Лівінгстон Роберт Дж., Емерсон Райан О., Шервуд Анна, Карлсон Крістофер С., Робінс Харлан С.

МПК: C12Q 1/68

Мітки: спосіб, систематично, множинних, похибки, коригування, плр-реакціях, ампліфікації, композиція

Формула / Реферат:

1. Композиція для стандартизації ефективності ампліфікації набору олігонуклеотидних праймерів для ампліфікації послідовностей перегрупованої нуклеїнової кислоти, які кодують один або більше рецепторів адаптивної імунної системи у біологічному зразку, отриманому з лімфоїдних клітин ссавців; кожний рецептор адаптивної імунної системи містить варіабельну та зв'язувальну області; композиція містить:множину синтетичних матричних...

Рекомбінантна молекула днк, яка вказує на присутність трансгенної події mon 87427 маїсу

Завантаження...

Номер патенту: 115762

Опубліковано: 26.12.2017

Автори: Фонсека Агустін Е., Келлі Ребекка А., Стекер Мартін А., Фен Пол К.К., Гарнаат Карл У., Ци Юлінь, Хуан Цзиньтай, Ередіа Оскар

МПК: C12N 15/82, C12N 15/29, A01H 5/00 ...

Мітки: вказує, рекомбінантна, яка, трансгенної, присутність, молекула, 87427, масу, днк, події

Формула / Реферат:

1. Рекомбінантна молекула ДНК, яка містить нуклеотидну послідовність, вибрану з групи, яка складається з SEQ ID NO: 1-8 і SEQ ID NO: 10, де вказана рекомбінантна молекула ДНК вказує на присутність події MON 87427, де вказана подія MON 87427 має нуклеотидну послідовність SEQ ID NO: 10, яка містить трансген, вбудований в геномну ДНК маїсу, і ділянки геномної ДНК маїсу, фланкуючі 3'- і 5'-кінці трансгенної вставки, де SEQ ID NO:...

Рекомбінантна молекула днк, яка вказує на присутність трансгенного об’єкта сої mon 87708

Завантаження...

Номер патенту: 115761

Опубліковано: 26.12.2017

Автори: Гупта Анджу, Ву Куншенг, Бернс Уен К., Брінкер Рональд Дж., Фен Пол. С.С., Малвен Маріанне, Хой Шио-Вай

МПК: C12N 15/82, A01H 5/00, C12N 15/29 ...

Мітки: молекула, сої, об'єкта, рекомбінантна, вказує, днк, присутність, 87708, яка, трансгенного

Формула / Реферат:

1. Рекомбінантна молекула ДНК, що містить нуклеотидну молекулу, яка містить нуклеотидну послідовність, вибрану з групи, яка складається з SEQ ID NO: 1-4 і 6-8 і комплементарних їм послідовностей, де вказана рекомбінантна молекула ДНК вказує на присутність трансгенного об'єкта MON 87708 і надавану тим самим наявність стійкості до дикамби, де вказаний трансгенний об’єкт MON 87708 має нуклеотидну послідовність SEQ ID NO: 6, яка містить...

Спосіб та комплект для аналізу ahasl генів у рослин

Завантаження...

Номер патенту: 115321

Опубліковано: 25.10.2017

Автори: Вітт Шері, Роджерс Корі

МПК: C12Q 1/68

Мітки: аналізу, ahasl, генів, комплект, рослин, спосіб

Формула / Реферат:

1. Спосіб аналізу AHASL гена рослин, який включає:(a) забезпечення ДНК, яка включає AHASL ген рослин;(b) ампліфікацію ДНК з застосуванням прямого праймера AHASL, зворотного праймера AHASL, полімерази та дезоксирибонуклеотидтрифосфатів;(c) виявлення продуктів ампліфікації за допомогою зонда AHASL дикого типу та толерантного до гербіцидів (НТ) зонда AHASL таким чином розпізнаючи AHASL ген як ген дикого типу або варіант для...

Композиції нyr1-похідних і способи лікування ними

Завантаження...

Номер патенту: 115305

Опубліковано: 25.10.2017

Автори: Йіман Майкл Р., Ло Гуаньпіншен, Едвардс Джон Е., Джр., Фу Юе, Ібрагім Ашраф С.

МПК: A61K 38/00, C07K 14/00, A61K 36/06 ...

Мітки: ними, способи, композиції, нyr1-похідних, лікування

Формула / Реферат:

1. Виділений поліпептид, що включає амінокислотну послідовність, вибрану з SEQ ID NO: 7 або SEQ ID NO: 9, причому згаданий поліпептид включає не більше ніж 20 суміжних амінокислот з SEQ ID NO: 2.2. Поліпептид за п. 1, який відрізняється тим, що амінокислотна послідовність згаданого поліпептиду складається з 14-20 амінокислот.3. Поліпептид за будь-яким одним з пунктів1 або 2, який відрізняється тим, що N-кінцевим амінокислотним...

Спосіб індикації шести та диференціації трьох видів збудників бабезіозів тварин у мультиплексній полімеразній ланцюговій реакції

Завантаження...

Номер патенту: 118964

Опубліковано: 11.09.2017

Автори: Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович, Курман Андрій Федорович, Мокрий Юрій Олексійович

МПК: C12Q 1/68, C12R 1/90

Мітки: спосіб, бабезіозів, мультиплексній, диференціації, збудникiв, реакції, індикації, видів, тварин, шести, ланцюговий, полімеразній, трьох

Формула / Реферат:

Спосіб визначення ДНК найпростіших роду Babesia у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена 18S рРНК, який відрізняється тим, що ампліфікацію означеного фрагмента гена 18S рРНК представників роду Babesia шести видів та видову диференціацію трьох із них здійснюють за допомогою системи олігонуклеотидних праймерів - двох прямих: BCANF 5'-GTGACCCAAACCCTCACCAGA-3' і BSPF 5'-ССА-TTGGAGGGCAAGTCTGGT-3' та трьох зворотних:...

Спосіб детекції нуклеїновокислотної послідовності-мішені в аналізі із розщепленням та подовженням рто

Завантаження...

Номер патенту: 115082

Опубліковано: 11.09.2017

Автори: Лі Йоунг Йо, Чан Йонг Йун

МПК: C12Q 1/68, C12Q 1/48, C12N 15/11 ...

Мітки: аналізі, детекції, рто, розщепленням, спосіб, послідовності-мішені, нуклеїновокислотної, подовженням

Формула / Реферат:

1. Спосіб детекції нуклеїновокислотної послідовності-мішені з ДНК або суміші нуклеїнових кислот в аналізі з РТОСЕ (розщепленням та подовженням РТО) в рідкій фазі, який включає:(a) гібридизацію нуклеїновокислотної послідовності-мішені з розташованими "угору по течії" олігонуклеотидом та РТО (олігонуклеотидом, що зондує та мітить); при цьому розташований "угору по течії" олігонуклеотид містить нуклеотидну...

Комбіноване лікування меланоми, що включає введення кобіметинібу і вемурафенібу

Завантаження...

Номер патенту: 114923

Опубліковано: 28.08.2017

Автори: Чан Айріс Т., Брей Гордон

МПК: A61K 31/437, A61K 31/4523, C12Q 1/68 ...

Мітки: кобіметинібу, меланоми, комбіноване, включає, введення, лікування, вемурафенібу

Формула / Реферат:

1. Фармацевтичний препарат, що містить: (і) першу композицію, яка містить [3,4-дифтор-2-[(2-фтор-4-йодфеніл)аміно]феніл][3-гідрокси-3-[(2S)-2-піперидиніл]-1-азетидиніл]метанон (сполуку II) або фармацевтично прийнятну сіль зазначеної сполуки в кількості від 20 до 60 мг; і (іі) другу композицію, яка містить {3-[5-(4-хлорфеніл)-1Н-піроло[2,3-b]піридин-3-карбоніл]-2,4-дифторфеніл}-амід пропан-1-сульфонової кислоти (сполуку І) або фармацевтично...

Спосіб ідентифікації рослини, що містить функціональний ген-відновник для цитоплазматичної чоловічої стерильності с-типу кукурудзи

Завантаження...

Номер патенту: 114886

Опубліковано: 28.08.2017

Автори: Жень Жуйхуа, Кумпатла Сіва П., Чжен Пейчжун, Томпсон Стивен А., Катер Ґері Л., рин Томас У., Нейджел Брюс А.

МПК: C12Q 1/68, C12N 15/82

Мітки: ідентифікації, стерильності, спосіб, рослини, функціональний, цитоплазматичної, ген-відновник, чоловічої, кукурудзи, с-типу, містить

Формула / Реферат:

1. Спосіб ідентифікації рослини, що містить функціональний ген-відновник для цитоплазматичної чоловічої стерильності С-типу кукурудзи, причому спосіб включає:виділення молекул нуклеїнової кислоти з рослини; іскринінг виділених молекул нуклеїнових кислот відносно молекули нуклеїнової кислоти, що містить маркерний полінуклеотид, вибраний з групи, що складається з SEQ ID NO: 49-68, де присутність маркерного полінуклеотиду...

Спосіб виявлення дезоксирибонуклеїнової кислоти (днк) бактерій cronobacter spp. (enterobacter sakazakii)

Завантаження...

Номер патенту: 118844

Опубліковано: 28.08.2017

Автори: Терьохіна Олена Вікторівна, Дерябін Олег Миколайович, Моня Юлія Іванівна, Коростіль Сергій Олексійович, Бергілевич Олександра Миколаївна, Касянчук Вікторія Вікторівна

МПК: C12Q 1/68, C12R 1/01

Мітки: enterobacter, кислоти, дезоксирибонуклеїнової, виявлення, sakazakii, днк, спосіб, бактерій, cronobacter

Формула / Реферат:

Спосіб виявлення дезоксирибонуклеїнової кислоти (ДНК) бактерій Cronobacter spp. (Enterobacter sakazakii), що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) за допомогою мультиплексного варіанту полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно синтезовані олігонуклеотидні праймери, які є специфічними фрагментами до гену 16S rRNA, з наступною...

Трасгенна рослина сої, стійка до гербіцидів

Завантаження...

Номер патенту: 114716

Опубліковано: 25.07.2017

Автори: Ван Ян, Гофман Томас, Толедо Сандра Ґрейс, Райт Тері Р., Секар Вайтхілінгам, Бредфіш Ґреґорі Елан, Паркгерст Дон Марі, Сміт Келі Ен, Цюй Юньсін Корі, Чжоу Нін, Кларк Лорен, Пареді Даякар, Расселл Шон Майкл, Бард Нейтан, Гелд Брюс

МПК: A01H 5/00, C12N 15/82, C12N 5/14 ...

Мітки: рослина, трасгенна, сої, гербіцидів, стійка

Формула / Реферат:

1. Трансгенна рослина сої, яка включає SEQ ID NO:18 в своєму геномі.2. Насінина сої, що включає геном, який містить SEQ ID NO:18, присутню у репрезентативному насінні, депонованому в Американській колекції типових культур (ATCC) під реєстр. № PTA-11993.3. Насіння рослини сої за п. 1, де вказане насіння містить вказану SEQ ID NO:18 в своєму геномі. 4. Рослина сої, одержана шляхом вирощування насіння за п. 2, де вказана...

Спосіб виявлення трансформанта сої pdab9582.814.19.1

Завантаження...

Номер патенту: 114481

Опубліковано: 26.06.2017

Автори: Сміт Келлі Енн, Ван Ян, Чжоу Нін, Кларк Лорен

МПК: C12Q 1/68

Мітки: спосіб, трансформанта, виявлення, pdab9582.814.19.1, сої

Формула / Реферат:

1. Спосіб виявлення нуклеотидної послідовності SEQ ID NO: 14 в зразку, що містить ДНК сої, який включає:(a) приведення вказаного зразка в контакт з першим праймером довжиною щонайменше 10 п. о., який вибірково зв'язується з фланкуючою послідовністю в положенні пар основ 1-1400 SEQ ID NO: 1 або її комплементом, і з другим праймером довжиною щонайменше 10 п. о., який вибірково зв'язується зі вставною послідовністю в положенні пар основ...

Спосіб індикації днк бактерії chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117100

Опубліковано: 12.06.2017

Автори: Ксьонз Ігор Миколайович, Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович

МПК: C12Q 1/68, C12R 1/01

Мітки: реакції, головного, фрагмента, момp, ланцюговий, видової, гена, диференціації, pecorum, шляхом, chlamydia, днк, ампліфікації, білка, мембрани, спосіб, полімеразній, бактерії, індикації

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia pecorum здійснюють за допомогою пари праймерів: прямого: ChPecMOMPL 5'-TCCAATACGCACAATCGAAA-3' та зворотного: ChPecMOMPR 5'-GTAAGACAACGCTGCACCAA-3', з одержанням...

Спосіб індикації днк бактерії chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117099

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: C12R 1/01, C12Q 1/68

Мітки: полімеразній, шляхом, мембрани, білка, фрагмента, ланцюговий, chlamydia, реакції, бактерії, головного, індикації, диференціації, днк, спосіб, ампліфікації, гена, видової, момp

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia suis здійснюють за допомогою пари праймерів: прямого: ChSuMOMPL: 5'- TTCTTTGCAATGCTGCTGAA-3' та зворотного: ChSuMOMPR: 5'- ATCAAAGCTTGCTCGAGACC-3', з одержанням...

Спосіб індикації днк бактерії chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 117097

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: C12Q 1/68, C12R 1/01

Мітки: білка, шляхом, реакції, мембрани, днк, видової, ланцюговий, момр, гена, головного, бактерії, диференціації, індикації, полімеразній, psittaci, ампліфікації, фрагмента, chlamydia, спосіб

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia psittaci здійснюють за допомогою пари праймерів: прямого: ChPsMOMPL: 5'-GCACTATGTGGGAAGGTGCT-3' та зворотного: ChPsMOMPR: 5'-CCATTTGCTTCTGGCTGATT-3', з одержанням...

Спосіб індикації днк бактерії chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117091

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: C12Q 1/68, C12R 1/01

Мітки: спосіб, abortus, полімеразній, фрагмента, шляхом, видової, ампліфікації, головного, мембрани, ланцюговий, індикації, бактерії, днк, гена, диференціації, білка, реакції, момp, chlamydia

Формула / Реферат:

Спосіб індикації ДНК бактерій Chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР) для її видової диференціації, який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia abortus здійснюють за допомогою пари праймерів: прямого: ChAbMOMPL: 5'-GGATAGACCCAACATCGCTT-3' та зворотного: ChAbMOMPR:...

Спосіб визначення зиготності гена fad-2 каноли з використанням плр із детекцією за кінцевою точкою

Завантаження...

Номер патенту: 114302

Опубліковано: 25.05.2017

Автори: Чаннабасаварадхя Чандра Шекара А., Убаясена Ласанта Чандана, Елерт Зоє

МПК: C07H 21/04, C12Q 1/68

Мітки: спосіб, детекцією, кінцевою, fad-2, точкою, плр, використанням, зиготності, визначення, канолі, гена

Формула / Реферат:

1. Спосіб визначення зиготності рослини каноли, яка включає ген fad-2, причому згідно зі згаданим способом:одержують зразок геномної ДНК із рослини каноли;гібридизують зразок геномної ДНК з першим праймером і другим праймером, причому перший праймер і другий праймер містять SEQ ID NO: 2 і SEQ ID NO: 3;піддають згаданий зразок умовам полімеразної ланцюгової реакції (ПЛР), при яких утворюється амплікон;надають...

Спосіб визначення зиготності гена fad3 в канолі

Завантаження...

Номер патенту: 114301

Опубліковано: 25.05.2017

Автори: Елерт Зоє, Чаннабасаварадхя Чандра Шекара А., Убаясена Ласанта Чандана, Гупта Манджу

МПК: C07H 21/04, C12Q 1/68

Мітки: зиготності, спосіб, визначення, канолі, гена

Формула / Реферат:

1. Спосіб визначення зиготності рослини каноли, що містить ген fad-3c, причому згідно зі згаданим способом:отримують зразок геномної ДНК з рослини каноли;гібридизують зразок геномної ДНК з першим праймером і другим праймером, де перший праймер і другий праймер містять SEQ ID NO: 2 і SEQ ID NO: 3; піддають згаданий зразок умовам полімеразної ланцюгової реакції (ПЛР), при яких утворюється амплікон;надають можливість...

Стійка до гербіцидів рослина сої і спосіб її ідентифікації

Завантаження...

Номер патенту: 114275

Опубліковано: 25.05.2017

Автори: Ферюлло Жан-Марк, Ебі Марк Алан, Ебі Уілльям Х., де Беккелер Марк, Леттоу Леслі Джеймс, Верхаге Стівен, Вельц Гюнтер, Мейсон Джастін Томас, Хабекс Верле

МПК: A01H 5/00, C12N 5/14, C12N 15/82 ...

Мітки: стійка, сої, гербіцидів, рослина, спосіб, ідентифікації

Формула / Реферат:

1. Рослина сої, її клітина, частина, насіння або потомство, які містять в своєму геномі елітну подію EE-GM3, що являє собою чужорідну ДНК в визначеному локусі, як це міститься в еталонній насінині, депонованій в NCIMB під номером NCIMB 41659, де вказана чужорідна ДНК включає нуклеотидну послідовність SEQ ID NO: 11 від нуклеотидного положення 1452 до нуклеотидного положення 16638, і де вказана подія EE-GM3 також містить 5'-фланкуючу ділянку,...

Спосіб визначення культур lactobacillus casei, lactobacillus paracasei та lactobacillus paracasei subsp. paracasei за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 114260

Опубліковано: 10.05.2017

Автори: Жукова Ярослава Фрідріхівна, Мудрак Тетяна Петрівна, Науменко Оксана Василівна, Вакуленко Микола Михайлович, Петров Пилип Ігорович

МПК: C12Q 1/68, C12Q 1/04, C12N 15/11, C12R 1/225 ...

Мітки: реакції, ланцюгової, визначення, спосіб, праймерів, специфічних, олігонуклеотидних, допомогою, paracasei, casei, пари, полімеразної, subsp, методом, культур, lactobacillus

Формула / Реферат:

Спосіб визначення культур Lactobacillus casei, Lactobacillus paracasei та Lactobacillus paracasei subsp. paracasei за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції у заквашувальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культур Lactobacillus casei,...

Стійка до гербіцидів рослина сої і спосіб її ідентифікації

Завантаження...

Номер патенту: 114171

Опубліковано: 10.05.2017

Автори: Ферюлло Жан-Марк, Ебі Уілльям Х., Вельц Гюнтер, Мейсон Джастін Томас, Верхаге Стівен, Ебі Марк Алан, Леттоу Леслі Джеймс, де Беккелер Марк, Хабекс Верле

МПК: C12N 5/14, A01H 5/00, C12N 15/82 ...

Мітки: стійка, рослина, гербіцидів, ідентифікації, сої, спосіб

Формула / Реферат:

1. Трансгенна рослина сої або її клітина, частина, насіння або потомство, які містять в своєму геномі елітну подію EE-GM3 і елітну подію EE-GM2, де EE-GM3 являє собою чужорідну ДНК у певному локусі, як це міститься у еталонному насінні, депонованому в NCIMB під номером доступу NCIMB 41659, і EE-GM2 являє собою чужорідну ДНК у певному локусі, як це міститься в еталонному насінні, депонованому в NCIMB під номером доступу NCIMB 41660, де...

Спосіб детекції патогенних для людини бабезій за допомогою мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 115268

Опубліковано: 10.04.2017

Автори: Похил Сергій Іванови, Тимченко Олена Миколаївна, Казмірчук Віктор Володимирович, Білозоров Олексій Павлович, Торянік Інна Іванівна, Круглова Тетяна Анатоліївна, Костиря Ірина Анатоліївна, Лець Вікторія Василівна, Чигиринська Ніла Анатоліївна

МПК: G01N 33/50, A61K 35/68, C12Q 1/68 ...

Мітки: реакції, патогенних, ланцюгової, бабезій, детекції, мультиплексної, допомогою, полімеразної, людини, спосіб

Формула / Реферат:

Спосіб детекції патогенних для людини бабезій за допомогою мультиплексної полімеразної ланцюгової реакції (ПЛР), що включає виявлення специфічних ампліконів (копій фрагментів гену 18S rRNA Babesia microti, В. divergens + В. venatorum), попередньо одержаних за допомогою мультиплексної ПЛР, який відрізняється тим, що для відтворення реакції використовують праймери BabUnF, BabMicR і BabDivR із такою послідовністю нуклеотидів:BabUnF 5' -...

Спосіб визначення зиготності bm3 мутантного алеля і алеля comt дикого типу з використанням тканини рослини кукурудзи

Завантаження...

Номер патенту: 113613

Опубліковано: 27.02.2017

Автори: ван Опдорп Натан, Кумпатла Сіва П., Вей Чень, Чаннабасаварадхя Чандра-Шекара

МПК: C12N 15/29, A01H 5/00, C12Q 1/68 ...

Мітки: визначення, рослини, тканини, дикого, зиготності, використанням, мутантного, алеля, спосіб, типу, кукурудзи

Формула / Реферат:

1. Спосіб визначення зиготності bm3 мутантного алеля і алеля COMT дикого типу з використанням тканини рослини кукурудзи, при цьому спосіб включає в себе:одержання зразка ізольованої геномної ДНК з тканини рослини кукурудзи;здійснення контакту в умовах високої жорсткості ізольованої геномної ДНК з першою молекулою нуклеїнової кислоти, що має нуклеотидну послідовність, яка містить від 10 до 35 суміжних нуклеотидів...

Спосіб визначення мутацій гена notch1

Завантаження...

Номер патенту: 112949

Опубліковано: 10.01.2017

Автори: Абраменко Ірина Вікторівна, Чумак Анатолій Андрійович, Білоус Надія Іванівна

МПК: C12Q 1/68

Мітки: notch1, визначення, спосіб, мутацій, гена

Формула / Реферат:

Спосіб визначення мутацій гена NOTCH1, що включає отримання генетичного матеріалу з клітин периферичної крові, ампліфікацію фрагмента гена в ділянці мутації у присутності барвника SYBR green в режимі реального часу та оцінку рівня ампліфікації порівняно з контрольним геном b-мікроглобуліну (В2М) за значенням порогового дельта циклу (DСТ) і характеристиками кривої плавлення, який відрізняється тим, що порівнюється рівень експресії мутованого...

Спосіб якісного та кількісного визначення вмісту біфідобактерій за допомогою специфічних праймерів методом полімеразної ланцюгової реакції реального часу

Завантаження...

Номер патенту: 112731

Опубліковано: 26.12.2016

Автори: Кітам Володимир Олегович, Шевченко Тетяна Вікторівна, Янковський Дмитро Станіславович, Літовченко Олександр Вікторович, Коробка Вадим Леонідович, Шевченко Любов Миколаївна, Димент Галина Семенівна

МПК: C12Q 1/68, C12N 15/11

Мітки: якісного, спосіб, вмісту, реакції, біфідобактерій, часу, методом, визначення, праймерів, кількісного, реального, специфічних, полімеразної, ланцюгової, допомогою

Формула / Реферат:

Спосіб якісного та кількісного визначення вмісту біфідобактерій Bifidobacterium longum subsp. longum за допомогою специфічних праймерів методом полімеразної ланцюгової реакції реального часу, який відрізняється тим, що використовують праймери В. lonF 5'-TTTCTATTGAACAGACACAGGTTTGCCC-3' та В. lonR 5'-AAACTGATTTGCCGATTTTGCC-3', які дозволяють ампліфікувати ділянку CRISPR довжиною 268 пар нуклеотидів (1807…2074) В. longum subsp. longum, яка...

Спосіб визначення наявності або відсутності вставленої нуклеотидної послідовності в визначеному сайті вставки в об’ємному зразку нуклеїнової кислоти зі щонайменше 100 організмів

Завантаження...

Номер патенту: 112977

Опубліковано: 25.11.2016

Автор: Чаннабасаварадхя Чандра-Шекара

МПК: C12N 15/09, C12Q 1/68

Мітки: визначення, щонайменше, послідовності, зразку, кислоти, об'ємному, нуклеїнової, вставленої, нуклеотидної, відсутності, спосіб, сайті, визначеному, вставки, наявності, організмів

Формула / Реферат:

1. Спосіб визначення наявності або відсутності вставленої нуклеотидної послідовності в визначеному сайті вставки в об′ємному зразку нуклеїнової кислоти зі щонайменше 100 організмів, причому спосіб містить:приведення зразка нуклеїнової кислоти в контакт з:прямим праймером, здатним зв'язуватися з нуклеїновою кислотою вище сайта вставки; іпершим зворотним праймером, здатним зв′язуватися зі вставленою...

Спосіб визначення культур lactobacillus delbrueckii subsp. bulgaricus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 112951

Опубліковано: 10.11.2016

Автори: Науменко Оксана Василівна, Семенівська Олена Анатоліївна, Вакуленко Микола Михайлович, Жукова Ярослава Фрідріхівна

МПК: C12Q 1/68, C12Q 1/04, C12N 15/11, C12R 1/225 ...

Мітки: методом, специфічних, delbrueckii, полімеразної, визначення, спосіб, subsp, lactobacillus, культур, праймерів, олігонуклеотидних, реакції, допомогою, пари, bulgaricus, ланцюгової

Формула / Реферат:

Спосіб визначення культур Lactobacillus delbrueckii subsp. bulgaricus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культур Lactobacillus delbrueckii subsp. bulgaricus використовують пари олігонуклеотидних...

Спосіб виявлення генетично модифікованої сої методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 111914

Опубліковано: 24.06.2016

Автори: Вакуленко Микола Михайлович, Семенівська Олена Анатоліївна, Жукова Ярослава Фрідріхівна

МПК: C12Q 1/04, C12Q 1/68, C12N 15/11 ...

Мітки: методом, ланцюгової, спосіб, генетично, модифікованої, полімеразної, сої, виявлення, реакції

Формула / Реферат:

Спосіб виявлення генетично модифікованої сої у сировині та харчових продуктах методом полімеразної ланцюгової реакції, при якому застосовують пари праймерів, специфічних до маркерів: видоспецифічного гена Lectin сої Glycine max, який кодує білок лектин; гена CP4-EPSPS, з Agrobacterium tumefaciens, який кодує 5-енолпірувілшикімат-3-фосфатсинтазу; трансформаційної події GTS 40-3-2; промотору 35S з...

Спосіб визначення clostridium perfringens в харчових продуктах

Завантаження...

Номер патенту: 111266

Опубліковано: 11.04.2016

Автори: Пилипенко Людмила Миколаївна, Пилипенко Інна Василівна, Сава Василь Михайлович

МПК: C12Q 1/04, C12N 15/11, C12N 1/00 ...

Мітки: perfringens, визначення, продуктах, харчових, clostridium, спосіб

Формула / Реферат:

1. Спосіб визначення Clostridium perfringens в харчових продуктах, відповідно до якого з основної біомаси зразка виділяють клітини мікроорганізмів, проводять їх лізис в присутності інгібітора ДНКази і піддають ПЛР-аналізу з використанням пари праймерів, специфічних до гена 16S рибосомальної РНК Clostridium perfringens, який відрізняється тим, що амплікон геномної ДНК Clostridium perfringens, що виявляють, складає 209...

Спосіб визначення культур streptococcus thermophilus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 111130

Опубліковано: 25.03.2016

Автори: Жукова Ярослава Фрідріхівна, Чуманська Ганна Сергіївна, Мудрак Тетяна Петрівна, Науменко Оксана Василівна, Вакуленко Микола Михайлович

МПК: C12R 1/46, C12Q 1/68, C12N 15/11, C12Q 1/04 ...

Мітки: олігонуклеотидних, пари, thermophilus, streptococcus, полімеразної, праймерів, визначення, допомогою, ланцюгової, методом, специфічних, культур, реакції, спосіб

Формула / Реферат:

Спосіб визначення культур Streptococcus thermophilus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культур Streptococcus thermophilus використовують пари олігонуклеотидних праймерів до гена pbp2b:прямий праймер Stt F 5'-CAGCCGAAACCTATGCAACA-3' 20 bр...

Детекція нуклеїновокислотної послідовності-мішені в аналізі із розщепленням та подовженням рто

Завантаження...

Номер патенту: 110815

Опубліковано: 25.02.2016

Автори: Лі Йоунг Йо, Чан Йонг Йун

МПК: C12N 15/11, C12Q 1/68, C12Q 1/48 ...

Мітки: детекція, рто, подовженням, нуклеїновокислотної, аналізі, послідовності-мішені, розщепленням

Формула / Реферат:

1. Спосіб детекції нуклеїновокислотної послідовності-мішені з ДНК або суміші нуклеїнових кислот в аналізі з РТОСЕ (розщепленням та подовженням РТО), який включає:(a) гібридизацію нуклеїновокислотної послідовності-мішені з розташованими "угору по течії″ олігонуклеотидом та РТО (олігонуклеотидом, що зондує та мітить); при цьому розташований "угору по течії" олігонуклеотид містить нуклеотидну послідовності, що...

Спосіб передбачування рецидиву раку молочної залози при ендокринному лікуванні

Завантаження...

Номер патенту: 110790

Опубліковано: 25.02.2016

Автори: Вебер Карстен, Германн Матіас, Петри Крістоф, Федер Інке Сабін, Кроненветт Ральф, Дартманн Марайке, фон Тьорн Крістіан, Хенніг Гідо

МПК: C12Q 1/68

Мітки: молочної, лікуванні, рецидиву, залози, передбачування, раку, ендокринному, спосіб

Формула / Реферат:

1. Спосіб передбачування наслідків раку молочної залози в позитивній по рецептору естрогена і негативній по HER2 пухлини у пацієнта з раком молочної залози, причому вказаний спосіб включає: (a) визначення в зразку пухлини від вказаного пацієнта рівнів експресії РНК наступних 8 генів: UBE2C, BIRC5, DHCR7, STC2, AZGP1, RBBP8, IL6ST і MGP;(b) математичне комбінування величин рівня експресії для генів вказаного набору, причому ці...

Спосіб визначення присутності giardia lamblia у досліджуваному зразку та набір праймерів для його здійснення

Завантаження...

Номер патенту: 110767

Опубліковано: 10.02.2016

Автори: Федорич Павло Володимирович, Зелений Сергій Борисович

МПК: C12N 15/11, C12Q 1/04, C12R 1/90, C12Q 1/68 ...

Мітки: присутності, праймерів, набір, спосіб, здійснення, досліджуваному, зразку, визначення, giardia, lamblia

Формула / Реферат:

1. Спосіб визначення присутності Giardia lamblia у досліджуваному зразку методом полімеразної ланцюгової реакції в реальному часі, який відрізняється тим, що при проведенні полімеразної ланцюгової реакції як набір праймерів використовують прямий і зворотний праймери для детекції Giardia lamblia нуклеотидного складу:Forward: 5' - TCAACGTCAACCGCGGCTTCCGCGTCC-3' (SEQ ID NO: 1), таRevers: 5' -...

Спосіб визначення присутності pentatrichomonas hominis у досліджуваному зразку та набір праймерів для його здійснення

Завантаження...

Номер патенту: 110759

Опубліковано: 10.02.2016

Автори: Зелений Сергій Борисович, Федорич Павло Володимирович

МПК: C12R 1/90, C12Q 1/68, C12Q 1/04, C12N 15/11 ...

Мітки: зразку, досліджуваному, набір, праймерів, hominis, pentatrichomonas, присутності, визначення, здійснення, спосіб

Формула / Реферат:

1. Спосіб визначення присутності Pentatrichomonas hominis у досліджуваному зразку методом полімеразної ланцюгової реакції, який відрізняється тим, що при проведенні полімеразної ланцюгової реакції як набір праймерів, використовують прямий і зворотний праймери для детекції Pentatrichomonas hominis нуклеотидного складу:Forvard 5'-GGAGGAGGTAATGACCAGTT-3' (SEQ ID NO: 1), таRevers 5'-CTCTGTCGGCATCGTTTACA-3' (SEQ ID NO:...

Спосіб визначення днк бактерій виду chlamydia abortus, chlamydia pecorum, chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу р (rnase p rna)

Завантаження...

Номер патенту: 110546

Опубліковано: 12.01.2016

Автори: Ксьонз Ігор Миколайович, Цівенко Тетяна Михайлівна, Почерняєв Костянтин Федорович

МПК: C12Q 1/68, C12R 1/01

Мітки: днк, визначення, psittaci, abortus, гена, chlamydia, rnase, шляхом, кодує, спосіб, виду, полімеразній, реакції, ампліфікації, pecorum, фрагмента, ендорибонуклеазу, бактерій, ланцюговий

Формула / Реферат:

Спосіб визначення ДНК бактерій виду Chlamydia abortus, Chlamydia pecorum, Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу Р (RNase Р RNA), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки фрагмента гена RNase Р RNA здійснюють за допомогою пари праймерів: прямого:CHCPF:5`-GGAGAAACTCCAGGGGCCGT-3` та зворотного:...

Спосіб ідентифікації dipylidium caninum у популяції собак за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 103721

Опубліковано: 25.12.2015

Автори: Пономаренко Володимир Якович, Приходько Юрій Олександрович, Лаптій Олена Петрівна, Приходько Олена Юріївна, Кульшин Володимир Євгенович

МПК: C12N 15/10, C12Q 1/68

Мітки: ідентифікації, caninum, dipylidium, ланцюгової, спосіб, собак, популяції, допомогою, полімеразної, реакції

Формула / Реферат:

Спосіб ідентифікації Dipylidium caninum у популяції собак за допомогою полімеразної ланцюгової реакції, що включає проведення ПЛР, пробопідготовку, ампліфікацію, детекцію ампліфікаційної ДНК, який відрізняється тим, що використовують ДНК ген 12S рРНК, який складається з таких послідовностей пар праймерів:5’ - CAGCAAGTGAATCCGTTCAG-3’5’ – GCATCAAAACTCTAATAAGCAGCA-3’.