C12Q 1/68 — використовують нуклеїнові кислоти

Спосіб індикації днк бактерії chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 123070

Опубліковано: 12.02.2018

Автори: Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович, Корнієнко Марина Володимирівна

МПК: C12R 1/01, C12Q 1/68, A61K 39/118 ...

Мітки: індикації, момр, спосіб, ланцюговий, днк, avium, мембрани, гена, диференціації, бактерії, фрагменту, ампліфікації, chlamydia, полімеразній, білка, шляхом, головного, реакції, видової

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia avium здійснюють за допомогою пари праймерів: прямого: ChAvMOMPL: 5' - TTCTGGTGATCCTTGCGACC-3' та зворотного: ChAvMOMPR: 5'- GCTCCTAAAGTTGCACAACC - 3', з одержанням...

Спосіб визначення бацилярних збудників харчових отруєнь та псування харчових продуктів за генами токсичності

Завантаження...

Номер патенту: 122765

Опубліковано: 25.01.2018

Автори: Капрельянц Леонід Вікторович, Пилипенко Людмила Миколаївна, Ямборко Ганна Валентинівна, Іваниця Володимир Олексійович, Данілова Олена Іванівна, Пилипенко Інна Василівна

МПК: C12R 1/085, C12N 15/62, C12Q 1/68 ...

Мітки: продуктів, генами, спосіб, збудникiв, псування, визначення, отруєнь, бацилярних, харчових, токсичності

Формула / Реферат:

Спосіб визначення бацилярних збудників харчових отруєнь та псування харчових продуктів, що включає підготування дослідних зразків, виділення мікроорганізмів, виділення геномів ДНК попередньо виділених мікроорганізмів, проведення мультиплексної полімеразної ланцюгової реакції з використанням прямих і зворотних праймерів і електрофорез продуктів мультиплексної полімеразної ланцюгової реакції з використанням маркерів нуклеотидних фрагментів,...

Спосіб визначення еметогенних та ентеротоксигенних бацил в харчових продуктах

Завантаження...

Номер патенту: 122752

Опубліковано: 25.01.2018

Автори: Пилипенко Людмила Миколаївна, Іваниця Володимир Олексійович, Пилипенко Інна Василівна, Ільєва Олена Сергіївна, Капрельянц Леонід Вікторович, Ямборко Ганна Валентинівна, Данілова Олена Іванівна

МПК: C12Q 1/68, G01N 33/00, C12N 15/62 ...

Мітки: продуктах, ентеротоксигенних, бацил, еметогенних, спосіб, харчових, визначення

Формула / Реферат:

Спосіб визначення еметогенних та ентеротоксигенних бацил в харчових продуктах, що включає підготування дослідних зразків, відділення мікроорганізмів, виділення геномів ДНК попередньо відділених мікроорганізмів, проведення полімеразної ланцюгової реакції з використанням прямих і зворотних праймерів і електрофорез продуктів полімеразної ланцюгової реакції з використанням маркерів нуклеотидних фрагментів який відрізняється тим, що безпечність...

Спосіб визначення безпечності харчових продуктів за генами токсичності бацилярних збудників харчових отруєнь

Завантаження...

Номер патенту: 122751

Опубліковано: 25.01.2018

Автори: Ямборко Ганна Валентинівна, Іваниця Володимир Олексійович, Пилипенко Людмила Миколаївна, Пилипенко Інна Василівна, Данілова Олена Іванівна

МПК: C12N 15/62, C12Q 1/68, G01N 33/00 ...

Мітки: харчових, безпечності, визначення, збудникiв, бацилярних, отруєнь, продуктів, генами, спосіб, токсичності

Формула / Реферат:

Спосіб визначення безпечності харчових продуктів за генами токсичності бацилярних збудників харчових отруєнь, що включає підготування дослідних зразків, відділення мікроорганізмів, виділення геномів ДНК попередньо відділених мікроорганізмів, проведення полімеразної ланцюгової реакції з використанням прямих і зворотних праймерів і електрофорез продуктів полімеразної ланцюгової реакції з використанням маркерів нуклеотидних фрагментів, який...

Композиція та спосіб коригування систематичної похибки ампліфікації в множинних плр-реакціях

Завантаження...

Номер патенту: 115783

Опубліковано: 26.12.2017

Автори: Лівінгстон Роберт Дж., Шервуд Анна, Робінс Харлан С., Карлсон Крістофер С., Емерсон Райан О.

МПК: C12Q 1/68

Мітки: систематично, плр-реакціях, композиція, множинних, коригування, спосіб, похибки, ампліфікації

Формула / Реферат:

1. Композиція для стандартизації ефективності ампліфікації набору олігонуклеотидних праймерів для ампліфікації послідовностей перегрупованої нуклеїнової кислоти, які кодують один або більше рецепторів адаптивної імунної системи у біологічному зразку, отриманому з лімфоїдних клітин ссавців; кожний рецептор адаптивної імунної системи містить варіабельну та зв'язувальну області; композиція містить:множину синтетичних матричних...

Рекомбінантна молекула днк, яка вказує на присутність трансгенної події mon 87427 маїсу

Завантаження...

Номер патенту: 115762

Опубліковано: 26.12.2017

Автори: Стекер Мартін А., Келлі Ребекка А., Хуан Цзиньтай, Фен Пол К.К., Гарнаат Карл У., Ци Юлінь, Фонсека Агустін Е., Ередіа Оскар

МПК: A01H 5/00, C12N 15/29, C12N 15/82 ...

Мітки: 87427, події, яка, вказує, трансгенної, молекула, днк, рекомбінантна, масу, присутність

Формула / Реферат:

1. Рекомбінантна молекула ДНК, яка містить нуклеотидну послідовність, вибрану з групи, яка складається з SEQ ID NO: 1-8 і SEQ ID NO: 10, де вказана рекомбінантна молекула ДНК вказує на присутність події MON 87427, де вказана подія MON 87427 має нуклеотидну послідовність SEQ ID NO: 10, яка містить трансген, вбудований в геномну ДНК маїсу, і ділянки геномної ДНК маїсу, фланкуючі 3'- і 5'-кінці трансгенної вставки, де SEQ ID NO:...

Рекомбінантна молекула днк, яка вказує на присутність трансгенного об’єкта сої mon 87708

Завантаження...

Номер патенту: 115761

Опубліковано: 26.12.2017

Автори: Гупта Анджу, Ву Куншенг, Бернс Уен К., Хой Шио-Вай, Фен Пол. С.С., Малвен Маріанне, Брінкер Рональд Дж.

МПК: C12N 15/82, A01H 5/00, C12N 15/29 ...

Мітки: вказує, об'єкта, днк, присутність, яка, молекула, 87708, сої, трансгенного, рекомбінантна

Формула / Реферат:

1. Рекомбінантна молекула ДНК, що містить нуклеотидну молекулу, яка містить нуклеотидну послідовність, вибрану з групи, яка складається з SEQ ID NO: 1-4 і 6-8 і комплементарних їм послідовностей, де вказана рекомбінантна молекула ДНК вказує на присутність трансгенного об'єкта MON 87708 і надавану тим самим наявність стійкості до дикамби, де вказаний трансгенний об’єкт MON 87708 має нуклеотидну послідовність SEQ ID NO: 6, яка містить...

Спосіб та комплект для аналізу ahasl генів у рослин

Завантаження...

Номер патенту: 115321

Опубліковано: 25.10.2017

Автори: Роджерс Корі, Вітт Шері

МПК: C12Q 1/68

Мітки: рослин, спосіб, аналізу, комплект, ahasl, генів

Формула / Реферат:

1. Спосіб аналізу AHASL гена рослин, який включає:(a) забезпечення ДНК, яка включає AHASL ген рослин;(b) ампліфікацію ДНК з застосуванням прямого праймера AHASL, зворотного праймера AHASL, полімерази та дезоксирибонуклеотидтрифосфатів;(c) виявлення продуктів ампліфікації за допомогою зонда AHASL дикого типу та толерантного до гербіцидів (НТ) зонда AHASL таким чином розпізнаючи AHASL ген як ген дикого типу або варіант для...

Композиції нyr1-похідних і способи лікування ними

Завантаження...

Номер патенту: 115305

Опубліковано: 25.10.2017

Автори: Ло Гуаньпіншен, Йіман Майкл Р., Ібрагім Ашраф С., Фу Юе, Едвардс Джон Е., Джр.

МПК: A61K 38/00, C07K 14/00, A61K 36/06 ...

Мітки: способи, нyr1-похідних, лікування, ними, композиції

Формула / Реферат:

1. Виділений поліпептид, що включає амінокислотну послідовність, вибрану з SEQ ID NO: 7 або SEQ ID NO: 9, причому згаданий поліпептид включає не більше ніж 20 суміжних амінокислот з SEQ ID NO: 2.2. Поліпептид за п. 1, який відрізняється тим, що амінокислотна послідовність згаданого поліпептиду складається з 14-20 амінокислот.3. Поліпептид за будь-яким одним з пунктів1 або 2, який відрізняється тим, що N-кінцевим амінокислотним...

Спосіб індикації шести та диференціації трьох видів збудників бабезіозів тварин у мультиплексній полімеразній ланцюговій реакції

Завантаження...

Номер патенту: 118964

Опубліковано: 11.09.2017

Автори: Курман Андрій Федорович, Мокрий Юрій Олексійович, Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: C12R 1/90, C12Q 1/68

Мітки: видів, трьох, ланцюговий, диференціації, спосіб, шести, реакції, полімеразній, індикації, збудникiв, тварин, бабезіозів, мультиплексній

Формула / Реферат:

Спосіб визначення ДНК найпростіших роду Babesia у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена 18S рРНК, який відрізняється тим, що ампліфікацію означеного фрагмента гена 18S рРНК представників роду Babesia шести видів та видову диференціацію трьох із них здійснюють за допомогою системи олігонуклеотидних праймерів - двох прямих: BCANF 5'-GTGACCCAAACCCTCACCAGA-3' і BSPF 5'-ССА-TTGGAGGGCAAGTCTGGT-3' та трьох зворотних:...

Спосіб детекції нуклеїновокислотної послідовності-мішені в аналізі із розщепленням та подовженням рто

Завантаження...

Номер патенту: 115082

Опубліковано: 11.09.2017

Автори: Чан Йонг Йун, Лі Йоунг Йо

МПК: C12Q 1/68, C12Q 1/48, C12N 15/11 ...

Мітки: подовженням, нуклеїновокислотної, спосіб, аналізі, послідовності-мішені, детекції, рто, розщепленням

Формула / Реферат:

1. Спосіб детекції нуклеїновокислотної послідовності-мішені з ДНК або суміші нуклеїнових кислот в аналізі з РТОСЕ (розщепленням та подовженням РТО) в рідкій фазі, який включає:(a) гібридизацію нуклеїновокислотної послідовності-мішені з розташованими "угору по течії" олігонуклеотидом та РТО (олігонуклеотидом, що зондує та мітить); при цьому розташований "угору по течії" олігонуклеотид містить нуклеотидну...

Комбіноване лікування меланоми, що включає введення кобіметинібу і вемурафенібу

Завантаження...

Номер патенту: 114923

Опубліковано: 28.08.2017

Автори: Чан Айріс Т., Брей Гордон

МПК: A61K 31/437, C12Q 1/68, A61K 31/4523 ...

Мітки: лікування, комбіноване, вемурафенібу, меланоми, кобіметинібу, включає, введення

Формула / Реферат:

1. Фармацевтичний препарат, що містить: (і) першу композицію, яка містить [3,4-дифтор-2-[(2-фтор-4-йодфеніл)аміно]феніл][3-гідрокси-3-[(2S)-2-піперидиніл]-1-азетидиніл]метанон (сполуку II) або фармацевтично прийнятну сіль зазначеної сполуки в кількості від 20 до 60 мг; і (іі) другу композицію, яка містить {3-[5-(4-хлорфеніл)-1Н-піроло[2,3-b]піридин-3-карбоніл]-2,4-дифторфеніл}-амід пропан-1-сульфонової кислоти (сполуку І) або фармацевтично...

Спосіб ідентифікації рослини, що містить функціональний ген-відновник для цитоплазматичної чоловічої стерильності с-типу кукурудзи

Завантаження...

Номер патенту: 114886

Опубліковано: 28.08.2017

Автори: Жень Жуйхуа, Кумпатла Сіва П., Катер Ґері Л., Томпсон Стивен А., рин Томас У., Чжен Пейчжун, Нейджел Брюс А.

МПК: C12Q 1/68, C12N 15/82

Мітки: містить, цитоплазматичної, кукурудзи, с-типу, ідентифікації, ген-відновник, рослини, чоловічої, функціональний, стерильності, спосіб

Формула / Реферат:

1. Спосіб ідентифікації рослини, що містить функціональний ген-відновник для цитоплазматичної чоловічої стерильності С-типу кукурудзи, причому спосіб включає:виділення молекул нуклеїнової кислоти з рослини; іскринінг виділених молекул нуклеїнових кислот відносно молекули нуклеїнової кислоти, що містить маркерний полінуклеотид, вибраний з групи, що складається з SEQ ID NO: 49-68, де присутність маркерного полінуклеотиду...

Спосіб виявлення дезоксирибонуклеїнової кислоти (днк) бактерій cronobacter spp. (enterobacter sakazakii)

Завантаження...

Номер патенту: 118844

Опубліковано: 28.08.2017

Автори: Касянчук Вікторія Вікторівна, Дерябін Олег Миколайович, Терьохіна Олена Вікторівна, Бергілевич Олександра Миколаївна, Моня Юлія Іванівна, Коростіль Сергій Олексійович

МПК: C12Q 1/68, C12R 1/01

Мітки: днк, бактерій, cronobacter, sakazakii, enterobacter, кислоти, спосіб, дезоксирибонуклеїнової, виявлення

Формула / Реферат:

Спосіб виявлення дезоксирибонуклеїнової кислоти (ДНК) бактерій Cronobacter spp. (Enterobacter sakazakii), що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) за допомогою мультиплексного варіанту полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно синтезовані олігонуклеотидні праймери, які є специфічними фрагментами до гену 16S rRNA, з наступною...

Трасгенна рослина сої, стійка до гербіцидів

Завантаження...

Номер патенту: 114716

Опубліковано: 25.07.2017

Автори: Бард Нейтан, Райт Тері Р., Толедо Сандра Ґрейс, Гофман Томас, Расселл Шон Майкл, Паркгерст Дон Марі, Бредфіш Ґреґорі Елан, Пареді Даякар, Сміт Келі Ен, Цюй Юньсін Корі, Чжоу Нін, Ван Ян, Кларк Лорен, Секар Вайтхілінгам, Гелд Брюс

МПК: C12N 15/82, C12N 5/14, A01H 5/00 ...

Мітки: рослина, сої, гербіцидів, стійка, трасгенна

Формула / Реферат:

1. Трансгенна рослина сої, яка включає SEQ ID NO:18 в своєму геномі.2. Насінина сої, що включає геном, який містить SEQ ID NO:18, присутню у репрезентативному насінні, депонованому в Американській колекції типових культур (ATCC) під реєстр. № PTA-11993.3. Насіння рослини сої за п. 1, де вказане насіння містить вказану SEQ ID NO:18 в своєму геномі. 4. Рослина сої, одержана шляхом вирощування насіння за п. 2, де вказана...

Спосіб виявлення трансформанта сої pdab9582.814.19.1

Завантаження...

Номер патенту: 114481

Опубліковано: 26.06.2017

Автори: Ван Ян, Кларк Лорен, Сміт Келлі Енн, Чжоу Нін

МПК: C12Q 1/68

Мітки: виявлення, спосіб, pdab9582.814.19.1, трансформанта, сої

Формула / Реферат:

1. Спосіб виявлення нуклеотидної послідовності SEQ ID NO: 14 в зразку, що містить ДНК сої, який включає:(a) приведення вказаного зразка в контакт з першим праймером довжиною щонайменше 10 п. о., який вибірково зв'язується з фланкуючою послідовністю в положенні пар основ 1-1400 SEQ ID NO: 1 або її комплементом, і з другим праймером довжиною щонайменше 10 п. о., який вибірково зв'язується зі вставною послідовністю в положенні пар основ...

Спосіб індикації днк бактерії chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117100

Опубліковано: 12.06.2017

Автори: Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович, Корнієнко Марина Володимирівна

МПК: C12Q 1/68, C12R 1/01

Мітки: диференціації, мембрани, реакції, бактерії, chlamydia, індикації, спосіб, pecorum, ланцюговий, білка, полімеразній, шляхом, фрагмента, днк, видової, момp, гена, ампліфікації, головного

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia pecorum здійснюють за допомогою пари праймерів: прямого: ChPecMOMPL 5'-TCCAATACGCACAATCGAAA-3' та зворотного: ChPecMOMPR 5'-GTAAGACAACGCTGCACCAA-3', з одержанням...

Спосіб індикації днк бактерії chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117099

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: C12Q 1/68, C12R 1/01

Мітки: мембрани, ампліфікації, chlamydia, момp, бактерії, індикації, ланцюговий, шляхом, спосіб, гена, реакції, білка, днк, видової, фрагмента, диференціації, полімеразній, головного

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia suis здійснюють за допомогою пари праймерів: прямого: ChSuMOMPL: 5'- TTCTTTGCAATGCTGCTGAA-3' та зворотного: ChSuMOMPR: 5'- ATCAAAGCTTGCTCGAGACC-3', з одержанням...

Спосіб індикації днк бактерії chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 117097

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: C12R 1/01, C12Q 1/68

Мітки: бактерії, спосіб, полімеразній, головного, шляхом, psittaci, ампліфікації, chlamydia, днк, гена, видової, диференціації, мембрани, індикації, момр, білка, ланцюговий, реакції, фрагмента

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia psittaci здійснюють за допомогою пари праймерів: прямого: ChPsMOMPL: 5'-GCACTATGTGGGAAGGTGCT-3' та зворотного: ChPsMOMPR: 5'-CCATTTGCTTCTGGCTGATT-3', з одержанням...

Спосіб індикації днк бактерії chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117091

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: C12R 1/01, C12Q 1/68

Мітки: білка, днк, гена, реакції, ампліфікації, полімеразній, мембрани, диференціації, момp, спосіб, abortus, фрагмента, індикації, шляхом, ланцюговий, chlamydia, видової, головного, бактерії

Формула / Реферат:

Спосіб індикації ДНК бактерій Chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР) для її видової диференціації, який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia abortus здійснюють за допомогою пари праймерів: прямого: ChAbMOMPL: 5'-GGATAGACCCAACATCGCTT-3' та зворотного: ChAbMOMPR:...

Спосіб визначення зиготності гена fad-2 каноли з використанням плр із детекцією за кінцевою точкою

Завантаження...

Номер патенту: 114302

Опубліковано: 25.05.2017

Автори: Чаннабасаварадхя Чандра Шекара А., Убаясена Ласанта Чандана, Елерт Зоє

МПК: C12Q 1/68, C07H 21/04

Мітки: плр, детекцією, зиготності, визначення, кінцевою, використанням, спосіб, канолі, гена, точкою, fad-2

Формула / Реферат:

1. Спосіб визначення зиготності рослини каноли, яка включає ген fad-2, причому згідно зі згаданим способом:одержують зразок геномної ДНК із рослини каноли;гібридизують зразок геномної ДНК з першим праймером і другим праймером, причому перший праймер і другий праймер містять SEQ ID NO: 2 і SEQ ID NO: 3;піддають згаданий зразок умовам полімеразної ланцюгової реакції (ПЛР), при яких утворюється амплікон;надають...

Спосіб визначення зиготності гена fad3 в канолі

Завантаження...

Номер патенту: 114301

Опубліковано: 25.05.2017

Автори: Гупта Манджу, Чаннабасаварадхя Чандра Шекара А., Елерт Зоє, Убаясена Ласанта Чандана

МПК: C07H 21/04, C12Q 1/68

Мітки: визначення, спосіб, зиготності, канолі, гена

Формула / Реферат:

1. Спосіб визначення зиготності рослини каноли, що містить ген fad-3c, причому згідно зі згаданим способом:отримують зразок геномної ДНК з рослини каноли;гібридизують зразок геномної ДНК з першим праймером і другим праймером, де перший праймер і другий праймер містять SEQ ID NO: 2 і SEQ ID NO: 3; піддають згаданий зразок умовам полімеразної ланцюгової реакції (ПЛР), при яких утворюється амплікон;надають можливість...

Стійка до гербіцидів рослина сої і спосіб її ідентифікації

Завантаження...

Номер патенту: 114275

Опубліковано: 25.05.2017

Автори: де Беккелер Марк, Хабекс Верле, Ебі Марк Алан, Верхаге Стівен, Мейсон Джастін Томас, Леттоу Леслі Джеймс, Ферюлло Жан-Марк, Ебі Уілльям Х., Вельц Гюнтер

МПК: C12N 5/14, A01H 5/00, C12N 15/82 ...

Мітки: стійка, ідентифікації, сої, гербіцидів, спосіб, рослина

Формула / Реферат:

1. Рослина сої, її клітина, частина, насіння або потомство, які містять в своєму геномі елітну подію EE-GM3, що являє собою чужорідну ДНК в визначеному локусі, як це міститься в еталонній насінині, депонованій в NCIMB під номером NCIMB 41659, де вказана чужорідна ДНК включає нуклеотидну послідовність SEQ ID NO: 11 від нуклеотидного положення 1452 до нуклеотидного положення 16638, і де вказана подія EE-GM3 також містить 5'-фланкуючу ділянку,...

Спосіб визначення культур lactobacillus casei, lactobacillus paracasei та lactobacillus paracasei subsp. paracasei за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 114260

Опубліковано: 10.05.2017

Автори: Петров Пилип Ігорович, Мудрак Тетяна Петрівна, Вакуленко Микола Михайлович, Жукова Ярослава Фрідріхівна, Науменко Оксана Василівна

МПК: C12R 1/225, C12N 15/11, C12Q 1/04, C12Q 1/68 ...

Мітки: casei, методом, subsp, олігонуклеотидних, специфічних, спосіб, paracasei, праймерів, полімеразної, визначення, ланцюгової, пари, допомогою, культур, lactobacillus, реакції

Формула / Реферат:

Спосіб визначення культур Lactobacillus casei, Lactobacillus paracasei та Lactobacillus paracasei subsp. paracasei за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції у заквашувальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культур Lactobacillus casei,...

Стійка до гербіцидів рослина сої і спосіб її ідентифікації

Завантаження...

Номер патенту: 114171

Опубліковано: 10.05.2017

Автори: де Беккелер Марк, Верхаге Стівен, Ебі Уілльям Х., Ебі Марк Алан, Ферюлло Жан-Марк, Мейсон Джастін Томас, Вельц Гюнтер, Леттоу Леслі Джеймс, Хабекс Верле

МПК: A01H 5/00, C12N 15/82, C12N 5/14 ...

Мітки: гербіцидів, сої, рослина, стійка, спосіб, ідентифікації

Формула / Реферат:

1. Трансгенна рослина сої або її клітина, частина, насіння або потомство, які містять в своєму геномі елітну подію EE-GM3 і елітну подію EE-GM2, де EE-GM3 являє собою чужорідну ДНК у певному локусі, як це міститься у еталонному насінні, депонованому в NCIMB під номером доступу NCIMB 41659, і EE-GM2 являє собою чужорідну ДНК у певному локусі, як це міститься в еталонному насінні, депонованому в NCIMB під номером доступу NCIMB 41660, де...

Спосіб детекції патогенних для людини бабезій за допомогою мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 115268

Опубліковано: 10.04.2017

Автори: Похил Сергій Іванови, Костиря Ірина Анатоліївна, Торянік Інна Іванівна, Казмірчук Віктор Володимирович, Чигиринська Ніла Анатоліївна, Тимченко Олена Миколаївна, Круглова Тетяна Анатоліївна, Лець Вікторія Василівна, Білозоров Олексій Павлович

МПК: G01N 33/50, C12Q 1/68, A61K 35/68 ...

Мітки: ланцюгової, спосіб, допомогою, мультиплексної, людини, полімеразної, детекції, бабезій, патогенних, реакції

Формула / Реферат:

Спосіб детекції патогенних для людини бабезій за допомогою мультиплексної полімеразної ланцюгової реакції (ПЛР), що включає виявлення специфічних ампліконів (копій фрагментів гену 18S rRNA Babesia microti, В. divergens + В. venatorum), попередньо одержаних за допомогою мультиплексної ПЛР, який відрізняється тим, що для відтворення реакції використовують праймери BabUnF, BabMicR і BabDivR із такою послідовністю нуклеотидів:BabUnF 5' -...

Спосіб визначення зиготності bm3 мутантного алеля і алеля comt дикого типу з використанням тканини рослини кукурудзи

Завантаження...

Номер патенту: 113613

Опубліковано: 27.02.2017

Автори: Чаннабасаварадхя Чандра-Шекара, Вей Чень, Кумпатла Сіва П., ван Опдорп Натан

МПК: A01H 5/00, C12Q 1/68, C12N 15/29 ...

Мітки: тканини, рослини, зиготності, визначення, алеля, типу, використанням, кукурудзи, мутантного, дикого, спосіб

Формула / Реферат:

1. Спосіб визначення зиготності bm3 мутантного алеля і алеля COMT дикого типу з використанням тканини рослини кукурудзи, при цьому спосіб включає в себе:одержання зразка ізольованої геномної ДНК з тканини рослини кукурудзи;здійснення контакту в умовах високої жорсткості ізольованої геномної ДНК з першою молекулою нуклеїнової кислоти, що має нуклеотидну послідовність, яка містить від 10 до 35 суміжних нуклеотидів...

Спосіб визначення мутацій гена notch1

Завантаження...

Номер патенту: 112949

Опубліковано: 10.01.2017

Автори: Білоус Надія Іванівна, Чумак Анатолій Андрійович, Абраменко Ірина Вікторівна

МПК: C12Q 1/68

Мітки: гена, notch1, мутацій, визначення, спосіб

Формула / Реферат:

Спосіб визначення мутацій гена NOTCH1, що включає отримання генетичного матеріалу з клітин периферичної крові, ампліфікацію фрагмента гена в ділянці мутації у присутності барвника SYBR green в режимі реального часу та оцінку рівня ампліфікації порівняно з контрольним геном b-мікроглобуліну (В2М) за значенням порогового дельта циклу (DСТ) і характеристиками кривої плавлення, який відрізняється тим, що порівнюється рівень експресії мутованого...

Спосіб якісного та кількісного визначення вмісту біфідобактерій за допомогою специфічних праймерів методом полімеразної ланцюгової реакції реального часу

Завантаження...

Номер патенту: 112731

Опубліковано: 26.12.2016

Автори: Шевченко Тетяна Вікторівна, Димент Галина Семенівна, Літовченко Олександр Вікторович, Янковський Дмитро Станіславович, Шевченко Любов Миколаївна, Коробка Вадим Леонідович, Кітам Володимир Олегович

МПК: C12Q 1/68, C12N 15/11

Мітки: кількісного, ланцюгової, вмісту, якісного, біфідобактерій, методом, часу, допомогою, визначення, полімеразної, праймерів, реакції, спосіб, специфічних, реального

Формула / Реферат:

Спосіб якісного та кількісного визначення вмісту біфідобактерій Bifidobacterium longum subsp. longum за допомогою специфічних праймерів методом полімеразної ланцюгової реакції реального часу, який відрізняється тим, що використовують праймери В. lonF 5'-TTTCTATTGAACAGACACAGGTTTGCCC-3' та В. lonR 5'-AAACTGATTTGCCGATTTTGCC-3', які дозволяють ампліфікувати ділянку CRISPR довжиною 268 пар нуклеотидів (1807…2074) В. longum subsp. longum, яка...

Спосіб визначення наявності або відсутності вставленої нуклеотидної послідовності в визначеному сайті вставки в об’ємному зразку нуклеїнової кислоти зі щонайменше 100 організмів

Завантаження...

Номер патенту: 112977

Опубліковано: 25.11.2016

Автор: Чаннабасаварадхя Чандра-Шекара

МПК: C12Q 1/68, C12N 15/09

Мітки: зразку, вставки, визначеному, вставленої, організмів, нуклеотидної, нуклеїнової, визначення, послідовності, щонайменше, об'ємному, відсутності, кислоти, спосіб, сайті, наявності

Формула / Реферат:

1. Спосіб визначення наявності або відсутності вставленої нуклеотидної послідовності в визначеному сайті вставки в об′ємному зразку нуклеїнової кислоти зі щонайменше 100 організмів, причому спосіб містить:приведення зразка нуклеїнової кислоти в контакт з:прямим праймером, здатним зв'язуватися з нуклеїновою кислотою вище сайта вставки; іпершим зворотним праймером, здатним зв′язуватися зі вставленою...

Спосіб визначення культур lactobacillus delbrueckii subsp. bulgaricus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 112951

Опубліковано: 10.11.2016

Автори: Науменко Оксана Василівна, Вакуленко Микола Михайлович, Семенівська Олена Анатоліївна, Жукова Ярослава Фрідріхівна

МПК: C12N 15/11, C12Q 1/68, C12R 1/225, C12Q 1/04 ...

Мітки: культур, lactobacillus, допомогою, праймерів, пари, реакції, олігонуклеотидних, спосіб, полімеразної, специфічних, визначення, delbrueckii, ланцюгової, subsp, методом, bulgaricus

Формула / Реферат:

Спосіб визначення культур Lactobacillus delbrueckii subsp. bulgaricus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культур Lactobacillus delbrueckii subsp. bulgaricus використовують пари олігонуклеотидних...

Спосіб виявлення генетично модифікованої сої методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 111914

Опубліковано: 24.06.2016

Автори: Семенівська Олена Анатоліївна, Жукова Ярослава Фрідріхівна, Вакуленко Микола Михайлович

МПК: C12Q 1/04, C12N 15/11, C12Q 1/68 ...

Мітки: модифікованої, полімеразної, генетично, ланцюгової, реакції, виявлення, методом, спосіб, сої

Формула / Реферат:

Спосіб виявлення генетично модифікованої сої у сировині та харчових продуктах методом полімеразної ланцюгової реакції, при якому застосовують пари праймерів, специфічних до маркерів: видоспецифічного гена Lectin сої Glycine max, який кодує білок лектин; гена CP4-EPSPS, з Agrobacterium tumefaciens, який кодує 5-енолпірувілшикімат-3-фосфатсинтазу; трансформаційної події GTS 40-3-2; промотору 35S з...

Спосіб визначення clostridium perfringens в харчових продуктах

Завантаження...

Номер патенту: 111266

Опубліковано: 11.04.2016

Автори: Пилипенко Інна Василівна, Сава Василь Михайлович, Пилипенко Людмила Миколаївна

МПК: C12N 15/11, C12N 1/00, C12Q 1/04 ...

Мітки: продуктах, харчових, clostridium, визначення, perfringens, спосіб

Формула / Реферат:

1. Спосіб визначення Clostridium perfringens в харчових продуктах, відповідно до якого з основної біомаси зразка виділяють клітини мікроорганізмів, проводять їх лізис в присутності інгібітора ДНКази і піддають ПЛР-аналізу з використанням пари праймерів, специфічних до гена 16S рибосомальної РНК Clostridium perfringens, який відрізняється тим, що амплікон геномної ДНК Clostridium perfringens, що виявляють, складає 209...

Спосіб визначення культур streptococcus thermophilus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 111130

Опубліковано: 25.03.2016

Автори: Мудрак Тетяна Петрівна, Науменко Оксана Василівна, Жукова Ярослава Фрідріхівна, Чуманська Ганна Сергіївна, Вакуленко Микола Михайлович

МПК: C12R 1/46, C12Q 1/68, C12N 15/11, C12Q 1/04 ...

Мітки: олігонуклеотидних, streptococcus, культур, специфічних, реакції, ланцюгової, методом, полімеразної, праймерів, thermophilus, спосіб, визначення, допомогою, пари

Формула / Реферат:

Спосіб визначення культур Streptococcus thermophilus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культур Streptococcus thermophilus використовують пари олігонуклеотидних праймерів до гена pbp2b:прямий праймер Stt F 5'-CAGCCGAAACCTATGCAACA-3' 20 bр...

Детекція нуклеїновокислотної послідовності-мішені в аналізі із розщепленням та подовженням рто

Завантаження...

Номер патенту: 110815

Опубліковано: 25.02.2016

Автори: Чан Йонг Йун, Лі Йоунг Йо

МПК: C12Q 1/68, C12Q 1/48, C12N 15/11 ...

Мітки: розщепленням, подовженням, аналізі, нуклеїновокислотної, детекція, послідовності-мішені, рто

Формула / Реферат:

1. Спосіб детекції нуклеїновокислотної послідовності-мішені з ДНК або суміші нуклеїнових кислот в аналізі з РТОСЕ (розщепленням та подовженням РТО), який включає:(a) гібридизацію нуклеїновокислотної послідовності-мішені з розташованими "угору по течії″ олігонуклеотидом та РТО (олігонуклеотидом, що зондує та мітить); при цьому розташований "угору по течії" олігонуклеотид містить нуклеотидну послідовності, що...

Спосіб передбачування рецидиву раку молочної залози при ендокринному лікуванні

Завантаження...

Номер патенту: 110790

Опубліковано: 25.02.2016

Автори: Кроненветт Ральф, Дартманн Марайке, Федер Інке Сабін, Германн Матіас, фон Тьорн Крістіан, Вебер Карстен, Петри Крістоф, Хенніг Гідо

МПК: C12Q 1/68

Мітки: ендокринному, залози, молочної, рецидиву, спосіб, раку, лікуванні, передбачування

Формула / Реферат:

1. Спосіб передбачування наслідків раку молочної залози в позитивній по рецептору естрогена і негативній по HER2 пухлини у пацієнта з раком молочної залози, причому вказаний спосіб включає: (a) визначення в зразку пухлини від вказаного пацієнта рівнів експресії РНК наступних 8 генів: UBE2C, BIRC5, DHCR7, STC2, AZGP1, RBBP8, IL6ST і MGP;(b) математичне комбінування величин рівня експресії для генів вказаного набору, причому ці...

Спосіб визначення присутності giardia lamblia у досліджуваному зразку та набір праймерів для його здійснення

Завантаження...

Номер патенту: 110767

Опубліковано: 10.02.2016

Автори: Зелений Сергій Борисович, Федорич Павло Володимирович

МПК: C12Q 1/04, C12N 15/11, C12Q 1/68, C12R 1/90 ...

Мітки: присутності, lamblia, досліджуваному, визначення, зразку, праймерів, спосіб, giardia, набір, здійснення

Формула / Реферат:

1. Спосіб визначення присутності Giardia lamblia у досліджуваному зразку методом полімеразної ланцюгової реакції в реальному часі, який відрізняється тим, що при проведенні полімеразної ланцюгової реакції як набір праймерів використовують прямий і зворотний праймери для детекції Giardia lamblia нуклеотидного складу:Forward: 5' - TCAACGTCAACCGCGGCTTCCGCGTCC-3' (SEQ ID NO: 1), таRevers: 5' -...

Спосіб визначення присутності pentatrichomonas hominis у досліджуваному зразку та набір праймерів для його здійснення

Завантаження...

Номер патенту: 110759

Опубліковано: 10.02.2016

Автори: Зелений Сергій Борисович, Федорич Павло Володимирович

МПК: C12R 1/90, C12Q 1/04, C12N 15/11, C12Q 1/68 ...

Мітки: присутності, спосіб, набір, досліджуваному, зразку, pentatrichomonas, визначення, hominis, праймерів, здійснення

Формула / Реферат:

1. Спосіб визначення присутності Pentatrichomonas hominis у досліджуваному зразку методом полімеразної ланцюгової реакції, який відрізняється тим, що при проведенні полімеразної ланцюгової реакції як набір праймерів, використовують прямий і зворотний праймери для детекції Pentatrichomonas hominis нуклеотидного складу:Forvard 5'-GGAGGAGGTAATGACCAGTT-3' (SEQ ID NO: 1), таRevers 5'-CTCTGTCGGCATCGTTTACA-3' (SEQ ID NO:...

Спосіб визначення днк бактерій виду chlamydia abortus, chlamydia pecorum, chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу р (rnase p rna)

Завантаження...

Номер патенту: 110546

Опубліковано: 12.01.2016

Автори: Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович, Цівенко Тетяна Михайлівна

МПК: C12R 1/01, C12Q 1/68

Мітки: спосіб, виду, chlamydia, реакції, pecorum, шляхом, abortus, днк, фрагмента, ампліфікації, ланцюговий, кодує, ендорибонуклеазу, rnase, psittaci, бактерій, полімеразній, визначення, гена

Формула / Реферат:

Спосіб визначення ДНК бактерій виду Chlamydia abortus, Chlamydia pecorum, Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу Р (RNase Р RNA), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки фрагмента гена RNase Р RNA здійснюють за допомогою пари праймерів: прямого:CHCPF:5`-GGAGAAACTCCAGGGGCCGT-3` та зворотного:...

Спосіб ідентифікації dipylidium caninum у популяції собак за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 103721

Опубліковано: 25.12.2015

Автори: Кульшин Володимир Євгенович, Пономаренко Володимир Якович, Лаптій Олена Петрівна, Приходько Юрій Олександрович, Приходько Олена Юріївна

МПК: C12Q 1/68, C12N 15/10

Мітки: популяції, полімеразної, dipylidium, допомогою, ланцюгової, спосіб, собак, caninum, ідентифікації, реакції

Формула / Реферат:

Спосіб ідентифікації Dipylidium caninum у популяції собак за допомогою полімеразної ланцюгової реакції, що включає проведення ПЛР, пробопідготовку, ампліфікацію, детекцію ампліфікаційної ДНК, який відрізняється тим, що використовують ДНК ген 12S рРНК, який складається з таких послідовностей пар праймерів:5’ - CAGCAAGTGAATCCGTTCAG-3’5’ – GCATCAAAACTCTAATAAGCAGCA-3’.