Патенти з міткою «рнк»

Спосіб виявлення рнк вірусу хвороби тешена свиней методом полімеразної ланцюгової реакції в режимі реального часу

Завантаження...

Номер патенту: 114872

Опубліковано: 27.03.2017

Автори: Музикіна Лариса Миколаївна, Спиридонов Владислав Генадійович, Ситюк Микола Петрович, Іщенко Людмила Мар'янівна, Галка Ігор Васильович

МПК: G01N 33/569

Мітки: часу, виявлення, реального, свиней, вірусу, спосіб, хвороби, тешена, рнк, режимі, ланцюгової, полімеразної, методом, реакції

Формула / Реферат:

Спосіб виявлення РНК вірусу хвороби Тешена свиней методом полімеразної ланцюгової реакції в режимі реального часу (ПЛР-РЧ), що включає виділення в досліджуваній пробі РНК вірусу, отримання кДНК, який відрізняється тим, що ампліфікація специфічної ділянки кДНК здійснюється з використанням специфічних олігонуклеотидних праймерів з наступними послідовностями: PTV-1-F - 5'TCTGTTGCTGTGAGGGTAATG, PTV-1-R - 5'AGTCTTGTGCCTGTTCTATGG, а також...

4′-азидо, 3′-фторзаміщені похідні нуклеозидів як інгібітори реплікації рнк вірусу гепатиту c

Завантаження...

Номер патенту: 110428

Опубліковано: 25.12.2015

Автори: Чжан Чжумін, Чжан Цзін, Сміт Марк, Таламас Франсіско Ксав'єр

МПК: A61K 31/708, A61P 31/14, A61K 31/7072 ...

Мітки: інгібітори, реплікації, 4'-азидо, похідні, нуклеозидів, рнк, гепатиту, вірусу, 3'-фторзаміщені

Формула / Реферат:

            1. Сполука формули І, І            в якій:            R1 являє собою Н, С1-С12-галогеналкіл або арил, при цьому вказаний арил являє собою феніл або нафтил, які можливо містять як замісники одну або декілька наступних груп: С1-С12-алкіл, С2-С7-алкеніл, С2-С7-алкініл, С1-С12-алкоксигрупу, галоген, С1-С12-галогеналкіл, -N(R1a)2,...

Спосіб виділення рнк з фіксованих в рідині буена та залитих в парафінові блоки зразків тканин

Завантаження...

Номер патенту: 102400

Опубліковано: 26.10.2015

Автори: Камишний Олександр Михайлович, Тарасевич Юлія В'ячеславівна, Путілін Денис Анатолійович, Деген Анна Сергіївна, Топол Інна Олександрівна, Камишна Віта Анатоліївна, Прозорова Тетяна Михайлівна, Жеребятьєв Олександр Сергійович

МПК: G01N 21/00

Мітки: буена, фіксованих, блоки, виділення, зразків, парафінові, рнк, спосіб, залитих, тканин, рідини

Формула / Реферат:

Спосіб виділення РНК з фіксованих в рідині Буена та залитих в парафінові блоки зразків тканин шляхом проведення депарафінізації зразка тканини з використанням ксилолу, гідратації шляхом послідовної промивки розчинами нижчих спиртів з концентрацією, що знижується, гомогенізації, виділення тотальної РНК, проведення зворотної транскрипції та полімеразно-ланцюгової реакції у реальному часі, який відрізняється тим, що гомогенізацію...

Спосіб виявлення рнк вірусу пташиного грипу субтипу h5n1 реакцією ізотермічної ампліфікації нуклеїнових кислот

Завантаження...

Номер патенту: 100226

Опубліковано: 10.07.2015

Автори: Постоєнко Володимир Олексійович, Головко Анатолій Миколайович, Сапачова Марина Артурівна, Карпуленко Максим Сергійович

МПК: C12Q 1/68

Мітки: спосіб, виявлення, рнк, вірусу, пташиного, реакцією, ампліфікації, ізотермічної, грипу, субтипу, нуклеїнових, кислот

Формула / Реферат:

Спосіб виявлення РНК вірусу грипу птиці субтипу H5N1 за допомогою реакції ізотермічної ампліфікації нуклеїнових кислот (LAMP), що включає індикацію в досліджуваних зразках специфічних фрагментів РНК за допомогою LAMP, який відрізняється тим, що для проведення LAMP використовують специфічну реакційну суміш при температурі 59 °C та 60 хвилин об'ємом 25 мкл, яка містить: 2,5 mL 10х Termopol буфера, 1 mmol/L бетаїну, 5 mmol/L MgSO4, 1,4...

Спосіб виявлення рнк вірусу чуми м’ясоїдних за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 94267

Опубліковано: 10.11.2014

Автори: Головко Оксана Анатольївна, Кацимон Вадим Васильович, Дерябін Олег Миколайович, Карпуленко Максим Сергійович

МПК: G01N 33/569, C12N 15/00, C07K 14/08 ...

Мітки: реакції, спосіб, полімеразної, вірусу, чуми, м'ясоїдних, виявлення, допомогою, зворотно-транскриптазної, рнк, ланцюгової

Формула / Реферат:

Спосіб виявлення РНК вірусу чуми м'ясоїдних за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (РНК) за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції (ЗТ-ПЛР), який відрізняється тим, що для проведення ЗТ-ПЛР використовують розроблені, штучно синтезовані, олігонуклеотидні праймери з наступною послідовністю...

Спосіб одночасної індикації днк мікоплазм та рнк вірусів діареї врх з подальшою ідентифікацією 1 та 2 генотипу збудника вірусної діареї за допомогою плр

Завантаження...

Номер патенту: 87122

Опубліковано: 27.01.2014

Автори: Стегній Борис Тимофійович, Герілович Антон Павлович, Горайчук Ірина Василівна, Болотін Віталій Ігорович

МПК: C12N 15/11

Мітки: рнк, діареї, ідентифікацією, днк, генотипу, вірусів, збудника, подальшою, мікоплазм, спосіб, одночасної, допомогою, врх, вірусної, індикації, плр

Формула / Реферат:

Спосіб одночасної індикації ДНК мікоплазм та РНК вірусів діареї ВРХ з подальшою ідентифікацією 1 та 2 генотипу збудника вірусної діареї за допомогою ПЛР, що включає екстракцію нуклеїнових кислот, зворотну транскрипцію та ампліфікацію, який відрізняється тим, що у першому раунді полімерної ланцюгової реакції(ПЛР) використовують праймерні системи GPO-1/MGSO та Р1/Р2, які фланкують ділянки гена 16S rRNA мікоплазм та Erns вірусу діареї ВРХ з...

Спосіб окремого виявлення днк і рнк

Завантаження...

Номер патенту: 81260

Опубліковано: 25.06.2013

Автори: Лісова Вікторія Вікторівна, Борисевич Борис Володимирович, Горальський Леонід Петрович

МПК: G01N 33/00

Мітки: днк, окремого, рнк, виявлення, спосіб

Формула / Реферат:

Спосіб окремого виявлення ДНК і РНК, що складається з наступних етапів: фарбування гістологічних зрізів сумішшю метилового зеленого та піроніну (17,5 мл 5%-го водного розчину піроніну та 10 мл 2%-го водного розчину метилового зеленого додають до 250 мл дистильованої води); просушування зрізів фільтрувальним папером; швидкого дофарбовування з одночасним зневодненням у двох порціях насиченого розчину піроніну в 96° етанолі; просвітлення у...

Одноланцюжкова кільцева рнк і спосіб її одержання

Завантаження...

Номер патенту: 101806

Опубліковано: 13.05.2013

Автори: Абе Хіросі, Іто Йосіхіро, Тойобуку Хідеказу, Абе Наоко

МПК: A61K 48/00, A61K 31/7105, A01H 1/02 ...

Мітки: кільцева, одержання, рнк, одноланцюжкова, спосіб

Формула / Реферат:

1. Одноланцюжкова кільцева РНК, що має тривалий або повільно вивільнюваний ефект інтерференції РНК, яка відрізняється тим, що одноланцюжкова кільцева РНК містить послідовність смислового ланцюга, послідовність антисмислового ланцюга, комплементарну послідовність смислового ланцюга, однакові або відмітні дві послідовності петлі між смисловим ланцюгом і антисмисловим ланцюгом, що з'єднують обидва ланцюги, де смисловий ланцюг і антисмисловий...

Сполуки-антагоністи рнк для модуляції активності бета-катеніну

Завантаження...

Номер патенту: 101317

Опубліковано: 25.03.2013

Автор: Ворм Йєспер

МПК: C12N 15/11, A61K 31/7088

Мітки: активності, бета-катеніну, сполуки-антагоністи, рнк, модуляції

Формула / Реферат:

1. Олігомер довжиною 16-18 нуклеїнових основ, здатний інгібувати експресію гена бета-катеніну, що включає безперервну послідовність нуклеїнових основ загальною довжиною 16-18 нуклеїнових основ, де вказана безперервна послідовність нуклеїнових основ є на 100 % гомологічною відповідній ділянці SEQ ID NO: 192.2. Олігомер за п. 1, де безперервна послідовність нуклеїнових основ не містить незбігів з відповідною ділянкою SEQ ID NO:...

Антагоністи рнк і їх застосування для інгібування her3

Завантаження...

Номер патенту: 99290

Опубліковано: 10.08.2012

Автор: Хеттьярн Май

МПК: A61K 31/7088, C12N 15/11, A61P 35/00 ...

Мітки: застосування, інгібування, рнк, антагоністи

Формула / Реферат:

1. Олігомер довжиною 10-25 нуклеїнових основ, що містить послідовність суміжних нуклеїнових основ, що містить у цілому 10-24 нуклеїнових основ, у якому і) зазначена послідовність суміжних нуклеїнових основ на 100 % гомологічна SEQ ID NO:211 або SEQ ID NO:200; або іі) зазначена послідовність суміжних нуклеїнових основ включає не більше одного помилкового спарювання з відповідною областю SEQ ID NO:211 або SEQ ID NO:200.2. Олігомер за п....

Спосіб виявлення рнк вірусу геморагічної септицемії форелі за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 54336

Опубліковано: 10.11.2010

Автори: Бабкін Михайло Валерійович, Головко Анатолій Миколайович, Гайдей Ольга Сергіївна, Дерябін Олег Миколайович, Ушкалов Валерій Олександрович

МПК: A61K 39/39

Мітки: виявлення, септицемії, геморагічної, реакції, форелі, полімеразної, спосіб, ланцюгової, допомогою, зворотно-транскриптазної, рнк, вірусу

Формула / Реферат:

Спосіб виявлення РНК вірусу геморагічної септицемії форелі за допомогою полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (РНК) за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції (ЗТ-ПЛР), який відрізняється тим, що для проведення ЗТ-ПЛР використовують штучно синтезовані вироджені олігонуклеотидні праймери з наступною послідовністю...

Спосіб виявлення рнк вірусу сказу за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 52924

Опубліковано: 10.09.2010

Автори: Дерябін Олег Миколайович, Ушкалов Валерій Олександрович, Головко Максим Анатолійович, Бабкін Михайло Валерійович

МПК: A61K 39/205

Мітки: зворотно-транскриптазної, полімеразної, виявлення, вірусу, рнк, ланцюгової, спосіб, реакції, допомогою, сказу

Формула / Реферат:

Спосіб виявлення РНК вірусу сказу за допомогою полімеразної ланцюгової реакції (ПЛР), що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (РНК) за допомогою "гніздового" варіанта зворотно-транскриптазної полімеразної ланцюгової реакції (ЗТ-ПЛР), який відрізняється тим, що для проведення ПЛР на першому етапі використовують штучно синтезовані олігонуклеотидні праймери з наступною послідовністю...

Спосіб виявлення рнк тешовірусів методом зворотно-транскриптазної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 51560

Опубліковано: 26.07.2010

Автори: Бова Тетяна Олександрівна, Сорока Віктор Іванович, Головко Анатолій Миколайович, Кацимон Вадим Васильович, Дерев'янко Станіслав Васильович

МПК: C12N 15/11

Мітки: спосіб, полімеразної, виявлення, реакції, тешовірусів, методом, зворотно-транскриптазної, ланцюгової, рнк

Формула / Реферат:

Спосіб виявлення РНК тешовірусів методом зворотно-транскриптазної полімеразної ланцюгової реакції, що включає виділення РНК з досліджуваних проб, ампліфікування специфічної ділянки кДНК інфекційного агента за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції з використанням двох штучно синтезованих оригінальних праймерів, який відрізняється тим, що використані праймери мають наступні послідовності:Sense Primer:...

Спосіб виявлення рнк ентеровірусів свиней b методом зворотно-транскриптазної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 51552

Опубліковано: 26.07.2010

Автори: Сорока Віктор Іванович, Головко Анатолій Миколайович, Бова Тетяна Олександрівна, Дерев'янко Станіслав Васильович, Кацимон Вадим Васильович

МПК: C12N 15/11

Мітки: свиней, ланцюгової, полімеразної, ентеровірусів, виявлення, реакції, спосіб, рнк, зворотно-транскриптазної, методом

Формула / Реферат:

Спосіб виявлення РНК ентеровірусів свиней В методом зворотно-транскриптазної полімеразної ланцюгової реакції, що включає виділення РНК з досліджуваних проб, ампліфікування специфічної ділянки комплементарної ДНК інфекційного агента за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції з використанням двох штучно синтезованих оригінальних праймерів, який відрізняється тим, що використані праймери мають наступні послідовності:...

Спосіб виявлення рнк ентеровірусів свиней а методом зворотнотранскриптазної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 51551

Опубліковано: 26.07.2010

Автори: Бова Тетяна Олександрівна, Дерев'янко Станіслав Васильович, Головко Анатолій Миколайович, Сорока Віктор Іванович, Кацимон Вадим Васильович

МПК: C12N 15/11

Мітки: ентеровірусів, реакції, рнк, полімеразної, виявлення, спосіб, зворотнотранскриптазної, свиней, ланцюгової, методом

Формула / Реферат:

Спосіб виявлення РНК ентеровірусів свиней А методом зворотнотранскриптазної полімеразної ланцюгової реакції, що включає виділення РНК з досліджуваних проб, ампліфікування специфічної ділянки кДНК інфекційного агента за допомогою зворотнотранскриптазної полімеразної ланцюгової реакції з використанням двох штучно синтезованих оригінальних праймерів, який відрізняється тим, що використані праймери мають наступні послідовності:Sense...

Спосіб виявлення рнк американського та європейського генотипів високопатогенного вірусу грипу птиці субтипу н7 та диференціація за геном гемаглютиніну

Завантаження...

Номер патенту: 42434

Опубліковано: 10.07.2009

Автори: Симоненко Сергій Іванович, Стегній Борис Тимофійович, Герілович Антон Павлович, Музика Денис Васильович, Солодянкін Олексій Сергійович

МПК: C12N 7/00

Мітки: генотипів, європейського, диференціація, птиці, спосіб, субтипу, високопатогенного, грипу, гемаглютиніну, геном, виявлення, вірусу, рнк, американського

Формула / Реферат:

Спосіб виявлення РНК Американського та Європейського генотипів високопатогенного вірусу грипу птиці субтипу Н7, що включає екстракцію РНК, її зворотну транскрипцію та ампліфікацію кДНК вірусу грипу як ПЛР-мішені, який відрізняється тим, що використовують праймери Aiv H7_fwd(Eu) 5'-ACT GAA AGA GGA GTG GAA GTC G-3'; Aiv H7_rew(Eu) 5'-GTG TCA TTG GGG TTT AGC АТС AGC-3' до Європейського генотипу та Aiv H7_fwd(Am) 5'-GCT GTG GCA ATT GGG АСА ААА...

Спосіб лікування злоякісних пухлин із застосуванням ксеногенних рнк

Завантаження...

Номер патенту: 86179

Опубліковано: 10.04.2009

Автор: Майсрімлер Барбара

МПК: A61K 31/7105, A61P 35/00, A61K 39/00 ...

Мітки: лікування, спосіб, застосуванням, пухлин, ксеногенних, рнк, злоякісних

Формула / Реферат:

1. Спосіб виготовлення лікарського засобу для лікування злоякісних пухлин, за винятком злоякісних захворювань шкіри, який відрізняється тим, що для виготовлення лікарського засобу застосовують ксеногенні РНК із тканин тварин, рослин та/або одноклітинних організмів, які еволюційно найбільш віддалені від організму, що підлягатиме лікуванню, в формі, придатній для системного застосування. 2. Спосіб за п. 1, який відрізняється тим, що...

Мінімальна плазмідна система для генерування інфекційних мінус-ланцюгових рнк вірусів з клонованої вірусної кднк, клітина-хазяїн, яка включає плазмідну систему, спосіб продукування інфекційного мінус-ланцюговог

Завантаження...

Номер патенту: 84254

Опубліковано: 10.10.2008

Автор: Хоффманн Ерік

МПК: A61P 31/14, A61K 39/145, A61P 31/16 ...

Мітки: мінімальна, систему, рнк, плазмідна, вірусів, мінус-ланцюговог, інфекційного, продукування, спосіб, кднк, система, плазмідну, генерування, клітина-хазяїн, клонованої, мінус-ланцюгових, включає, вірусної, інфекційних, яка

Формула / Реферат:

1. Мінімальна плазмідна система для генерування інфекційних мінус-ланцюгових РНК вірусів з клонованої вірусної кДНК, що включає набір плазмід, де кожна плазміда включає вірусну кДНК, що відповідає вірусному геномному сегменту, інсерційованому між промотором РНК-полімерази І (pol І) і термінаторною послідовністю, які здатні спрямовувати синтез вРНК, яка у свою чергу, інсерційована між промотором РНК-полімерази II (pol II) та сигналом...

Спосіб виявлення рнк вірусу діареї великої рогатої худоби

Завантаження...

Номер патенту: 31039

Опубліковано: 25.03.2008

Автори: Герілович Антон Павлович, Стегній Борис Тимофійович, Стегній Марина Юріївна, Лиманська Ольга Юріївна

МПК: C12N 7/00

Мітки: спосіб, вірусу, виявлення, рнк, великої, діареї, рогатої, худоби

Формула / Реферат:

Спосіб виявлення РНК вірусу діареї ВРХ, що включає екстракцію РНК, її зворотну транскрипцію та ампліфікацію кДНК вірусу ВД, який відрізняється тим, що використовують праймери BVDV_F (5' AGG CGA GCC ATG ССС ТTА GT 3') та BVDV_R (5' ТСТ GCA GCA CCC TAT CAG G З'), які фланкують ділянку UTR 5' за температури відпалу 56 °С і синтезують фрагмент довжиною 244 п.н.

Тест-система “dia-real-avian influenza” для виявлення рнк вірусу пташиного грипу типу а (h5n1) методом одностадійної зворотно-транскриптазної полімеразної ланцюгової реакції в режимі реального часу

Завантаження...

Номер патенту: 18814

Опубліковано: 15.11.2006

Автори: Семиноженко Володимир Петрович, Пилипенко Віталій Григорович, Степанюк Світлана Володимірівна, Найденов Валерій Георгійович, Кучерявенко Олексій Олександрович, Іванська Наіля Валєєвна, Шевчук Олександр Анатолійович, Синицин Віталій Анатолійович, Співак Микола Якович, Герман В'ячеслав Валентинович, Вудмаска Марія Іванівна, Горлов Юрій Іванович

МПК: A61K 39/21

Мітки: грипу, режимі, методом, пташиного, полімеразної, типу, рнк, часу, h5n1, influenza, реального, тест-система, реакції, вірусу, виявлення, зворотно-транскриптазної, одностадійної, dia-real-avian, ланцюгової

Формула / Реферат:

Тест-система «DIA-REAL-AVIAN INFLUENZA» для виявлення РНК вірусу пташиного грипу типу A (H5N1) методом одностадійної зворотно-транскриптазної полімеразної ланцюгової реакції в режимі реального часу, де на основі олігонуклеотидних праймерів з віріонної РНК-матриці вірусу грипу за допомогою зворотної транскриптази синтезуються вірусоспецифічні фрагменти кДНК трьох генів (висококонсервативна ділянка вірусу грипу типу А – ген М, ген Н5 та ген...

Похідні нуклеозиду як інгібітори рнк-залежної рнк вірусної полімерази

Завантаження...

Номер патенту: 73843

Опубліковано: 15.09.2005

Автори: Бхат Балкрішен, Кук Філліп Ден, Пракаш Тхазха П., Керролл Стівен С., Елдруп Енн Б., Прхавк Маріджа, Маккосс Малкольм, Бхат Неєліма, Сонг Кванлай, Олсен Девід Б.

МПК: A61K 31/7064, A61K 31/519, A61K 31/7068 ...

Мітки: рнк, полімерази, нуклеозиду, інгібітори, похідні, вірусної, рнк-залежної

Формула / Реферат:

1. Сполука структурної формули I:або її фармацевтично прийнятна сіль; деR1 являє собою С2-4-алкеніл, С2-4-алкініл або С1-4-алкіл, де алкіл є незаміщеним або заміщений гідрокси, аміно, C1-4-алкокси, C1-4-алкілтіо або одним-трьома атомами фтору;R2 являє собою водень, фтор, гідрокси, меркапто, C1-4-алкокси або С1-4-алкіл; або R1 і R2 разом з атомом...

Спосіб лікування запальних захворювань та пов’язаних з ними розладів та спосіб покращення рівня показників крові з використанням очищеної дріжджової рнк

Завантаження...

Номер патенту: 66416

Опубліковано: 17.05.2004

Автор: Ткачук Зеновій Юрійович

МПК: A61P 37/00, A61P 7/00, A61K 31/7105 ...

Мітки: рівня, розладів, запальних, очищеної, крові, використанням, ними, пов'язаних, показників, покращення, спосіб, рнк, лікування, дріжджової, захворювань

Формула / Реферат:

1. Спосіб лікування запалення та пов'язаних з запаленням захворювань за рахунок стабілізації клітинних мембран, який відрізняється тим, що ссавцям, які потребують такого лікування, призначають очищену дріжджову рибонуклеїнову кислоту в ефективній кількості, здатній покращувати симптоми запалення або пов'язаних з запаленням захворювань, та в фармакологічно придатних наповнювачах, носіях та розчинах.2. Спосіб згідно з п. 1, який...

Тест-система “dia-amplisens sars” для виявлення рнк коронавірусу sars методом зворотної транскрипції та полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 62794

Опубліковано: 15.12.2003

Автор: Шипулін Герман Олександрович

МПК: A61K 39/21

Мітки: зворотної, полімеразної, реакції, sars, рнк, транскрипції, методом, виявлення, тест-система, ланцюгової, коронавірусу, dia-amplisens

Формула / Реферат:

Тест-система для виявлення РНК коронавірусу SARS методом зворотної транскрипції та полімеразної ланцюгової реакції, що включає синтезування на основі олігонуклеотидних праймерів з віріонної РНК-матриці вірусу SARS за допомогою зворотної транскриптази вірусоспецифічної комплентарної ДНК, фрагмент якої потім ампліфікують в полімеразній ланцюговій реакції, яка відрізняється тим, що використовують метод екстракції РНК коронавірусу SARS, праймери...

Спосіб ампліфікації сегмента-мішені рнк

Завантаження...

Номер патенту: 26754

Опубліковано: 12.11.1999

Автори: Гвателлі Джон С., ДЖІНДЖІРАС Томас Реймонд, Вітфілд Крістіна Марі

МПК: C12Q 1/70, C12Q 1/68

Мітки: сегмента-мішені, ампліфікації, спосіб, рнк

Формула / Реферат:

1. Способ амплификации сегмента-мишени РНК, который содержит неперекрывающиеся 5'-субсегмент и 3'-субфрагмент, причем способ включает контактирование сегмента-мишени РНК с реакционной смесью, содержащей первый праймер, представляющий собой однонитевую ДНК и включающий последовательность, в достаточной мере комплементарную последовательности 3'-субсегмента сегмента-мишени и операбельно присоединенную к последовательности промотора, и второй...

1,1-біс-[2-(2,7-діацетоксифлуорениліден-9-гідразоно)тиазолідон-4-іл-5]-о-нітрофенилметан, що виявляє антивірусну дію відносно рнк- та днк- вмістних вірусів

Завантаження...

Номер патенту: 6146

Опубліковано: 29.12.1994

Автори: Лозюк Любов Василівна, Маслова Любов Іванівна

МПК: A61K 31/426, A61P 31/20, A61P 31/14 ...

Мітки: відносної, виявляє, рнк, вмістних, днк, вірусів, 1,1-біс-[2-(2,7-діацетоксифлуорениліден-9-гідразоно)тиазолідон-4-іл-5]-о-нітрофенилметан, дію, антивірусну

Формула / Реферат:

1,1 - Бис - [2 - (2,7 -диацетоксифлуоренилиден - 9 - гидразоно) тиазолидон - 4 - ил - 5] - о - нитрофенил - метан формулыобладающей антивирусным действием в отноше­нии РНК и ДНК-содержащих вирусов.