Патенти з міткою «полімеразної»

Спосіб диференційної діагностики африканської та класичної чуми свиней методом дуплексної полімеразної ланцюгової реакції у режимі реального часу

Завантаження...

Номер патенту: 122578

Опубліковано: 10.01.2018

Автори: Ничик Сергій Анатолійович, Спиридонов Владислав Генадійович, Галка Ігор Васильович, Мельничук Сергій Дмитрович, Іщенко Людмила Мар'янівна, Музикіна Лариса Миколаївна, Мандигра Світлана Станіславівна, Ситюк Микола Петрович, Коваленко Ганна Андріївна

МПК: G01N 33/48

Мітки: полімеразної, чуми, дуплексної, спосіб, ланцюгової, режимі, реакції, часу, методом, класичної, диференційної, свиней, реального, африканської, діагностики

Формула / Реферат:

Спосіб диференційної діагностики африканської та класичної чуми свиней (АЧС та КЧС) методом дуплексної полімеразної ланцюгової реакції у режимі реального часу, що включає ідентифікацію цільових ділянок гена B646L вірусу АЧС та 5' UTR вірусу КЧС, який відрізняється тим, що ампліфікація проводиться одночасно в одній пробірці з використанням двох пар специфічних праймерів: 1) для АЧС - ASF F (5' CTG СТС ATG GTA ТСА АТС ТТА TCG А 3') та ASF R...

Спосіб полімеразної ланцюгової реакції у режимі реального часу для діагностики африканської чуми свиней

Завантаження...

Номер патенту: 116390

Опубліковано: 25.05.2017

Автори: Спиридонов Владислав Геннадієвич, Ситюк Микола Петрович, Ничик Сергій Анатолійович, Галка Ігор Васильович

МПК: A61K 39/187, G01N 33/535

Мітки: полімеразної, діагностики, ланцюгової, африканської, режимі, часу, реакції, свиней, реального, спосіб, чуми

Формула / Реферат:

Спосіб полімеразної ланцюгової реакції у режимі реального часу для діагностики африканської чуми свиней, що призначений для виявлення в патологічному матеріалі (фрагменти лімфоїдних, паранхіматозних органів, тканин) ДНК вірусу АЧС шляхом приготування суспензії з патологічного субстрату, виділенням нуклеїнової кислоти та її ампліфікації, який відрізняється тим, що детекцію ДНК вірусу АЧС здійснюють за специфічною ділянкою гена, що кодує...

Спосіб визначення культур lactobacillus casei, lactobacillus paracasei та lactobacillus paracasei subsp. paracasei за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 114260

Опубліковано: 10.05.2017

Автори: Мудрак Тетяна Петрівна, Вакуленко Микола Михайлович, Науменко Оксана Василівна, Петров Пилип Ігорович, Жукова Ярослава Фрідріхівна

МПК: C12Q 1/68, C12N 15/11, C12Q 1/04 ...

Мітки: casei, специфічних, праймерів, subsp, спосіб, допомогою, реакції, методом, paracasei, визначення, полімеразної, ланцюгової, lactobacillus, пари, олігонуклеотидних, культур

Формула / Реферат:

Спосіб визначення культур Lactobacillus casei, Lactobacillus paracasei та Lactobacillus paracasei subsp. paracasei за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції у заквашувальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культур Lactobacillus casei,...

Спосіб ідентифікації шиготоксинутворюючих генів (stx1/stx2) escherichia coli методом полімеразної ланцюгової реакції в реальному часі

Завантаження...

Номер патенту: 115879

Опубліковано: 25.04.2017

Автори: Іщенко Людмила Мар'янівна, Стародуб Микола Федорович, Виговська Лілія Миколаївна, Спиридонов Владислав Генадійович, Новгородова Олександра Юріївна, Мачуський Олександр Вікторович, Мазур Тетяна Василівна, Ушкалов Валерій Олександрович

МПК: G01N 29/24, G01N 30/04, C12R 1/19 ...

Мітки: генів, часі, ланцюгової, методом, ідентифікації, реальному, спосіб, escherichia, шиготоксинутворюючих, полімеразної, реакції

Формула / Реферат:

Спосіб ідентифікації шиготоксиноутворюючих генів (stxl і stx2) Escherichia coli методом полімеразної ланцюгової реакції в реальному часі, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) ентерогеморагічних ешерихій за допомогою ферментативної реакції з шістьма штучно синтезованими олігонуклеотидними ланцюгами, які багаторазово копіюють специфічні ділянки ДНК інфекційного агента при певних...

Спосіб якісного та кількісного визначення видового складу багатокомпонентних бактеріальних препаратів за допомогою специфічних праймерів методом полімеразної ланцюгової реакції реального часу

Завантаження...

Номер патенту: 115774

Опубліковано: 25.04.2017

Автори: Коробка Вадим Леонідович, Димент Галина Семенівна, Шевченко Тетяна Вікторівна, Янковський Дмитро Станіславович, Шевченко Любов Миколаївна, Кітам Володимир Олегович, Літовченко Олександр Вікторович

МПК: C12R 1/01, C12N 1/20

Мітки: реакції, часу, специфічних, ланцюгової, багатокомпонентних, якісного, допомогою, кількісного, видового, праймерів, реального, спосіб, бактеріальних, методом, складу, визначення, препаратів, полімеразної

Формула / Реферат:

Спосіб якісного та кількісного визначення видового складу багатокомпонентного бактеріального препарату, щомістить представників родів Bifidobacterium, Lactobacillus, Propionibacterium, Lactococcus, Streptococcus та Acetobacter, за допомогою специфічних праймерів методом полімеразної ланцюгової реакції в режимі реального часу, який відрізняється тим, що визначають склад бактеріального препарату на рівні видів Lactobacillus acidophilus,...

Спосіб індикації salmonella spp. методом полімеразної ланцюгової реакції в реальному часі

Завантаження...

Номер патенту: 115440

Опубліковано: 10.04.2017

Автори: Іщенко Людмила Мар'янівна, Ушкалов Валерій Олександрович, Спиридонов Владислав Генадійович, Виговська Лілія Миколаївна, Мачуський Олександр Вікторович, Новгородова Олександра Юріївна, Стародуб Микола Федорович, Мазур Тетяна Василівна

МПК: C12Q 1/12, C12R 1/42, G01N 29/24 ...

Мітки: індикації, спосіб, реакції, методом, salmonella, часі, ланцюгової, реальному, полімеразної

Формула / Реферат:

Спосіб індикації Salmonella spp. методом полімеразної ланцюгової реакції в реальному часі, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) мікроорганізмів роду Salmonella за допомогою ферментативної реакції і трьох штучно синтезованих олігонуклеотидних ланцюгів, які дозволяють багаторазово копіювати специфічні ділянки ДНК сальмонел при певних температурних і часових параметрах та кількості...

Спосіб детекції патогенних для людини бабезій за допомогою мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 115268

Опубліковано: 10.04.2017

Автори: Костиря Ірина Анатоліївна, Торянік Інна Іванівна, Лець Вікторія Василівна, Казмірчук Віктор Володимирович, Білозоров Олексій Павлович, Похил Сергій Іванови, Круглова Тетяна Анатоліївна, Чигиринська Ніла Анатоліївна, Тимченко Олена Миколаївна

МПК: A61K 35/68, C12Q 1/68, G01N 33/50 ...

Мітки: спосіб, патогенних, бабезій, реакції, мультиплексної, допомогою, ланцюгової, людини, детекції, полімеразної

Формула / Реферат:

Спосіб детекції патогенних для людини бабезій за допомогою мультиплексної полімеразної ланцюгової реакції (ПЛР), що включає виявлення специфічних ампліконів (копій фрагментів гену 18S rRNA Babesia microti, В. divergens + В. venatorum), попередньо одержаних за допомогою мультиплексної ПЛР, який відрізняється тим, що для відтворення реакції використовують праймери BabUnF, BabMicR і BabDivR із такою послідовністю нуклеотидів:BabUnF 5' -...

Спосіб виявлення рнк вірусу хвороби тешена свиней методом полімеразної ланцюгової реакції в режимі реального часу

Завантаження...

Номер патенту: 114872

Опубліковано: 27.03.2017

Автори: Іщенко Людмила Мар'янівна, Ситюк Микола Петрович, Галка Ігор Васильович, Музикіна Лариса Миколаївна, Спиридонов Владислав Генадійович

МПК: G01N 33/569

Мітки: рнк, свиней, часу, режимі, вірусу, ланцюгової, хвороби, виявлення, реального, полімеразної, тешена, спосіб, реакції, методом

Формула / Реферат:

Спосіб виявлення РНК вірусу хвороби Тешена свиней методом полімеразної ланцюгової реакції в режимі реального часу (ПЛР-РЧ), що включає виділення в досліджуваній пробі РНК вірусу, отримання кДНК, який відрізняється тим, що ампліфікація специфічної ділянки кДНК здійснюється з використанням специфічних олігонуклеотидних праймерів з наступними послідовностями: PTV-1-F - 5'TCTGTTGCTGTGAGGGTAATG, PTV-1-R - 5'AGTCTTGTGCCTGTTCTATGG, а також...

Спосіб якісного та кількісного визначення вмісту біфідобактерій за допомогою специфічних праймерів методом полімеразної ланцюгової реакції реального часу

Завантаження...

Номер патенту: 112731

Опубліковано: 26.12.2016

Автори: Янковський Дмитро Станіславович, Кітам Володимир Олегович, Димент Галина Семенівна, Коробка Вадим Леонідович, Шевченко Тетяна Вікторівна, Літовченко Олександр Вікторович, Шевченко Любов Миколаївна

МПК: C12N 15/11, C12Q 1/68

Мітки: допомогою, полімеразної, визначення, біфідобактерій, кількісного, реального, методом, праймерів, реакції, спосіб, специфічних, ланцюгової, якісного, вмісту, часу

Формула / Реферат:

Спосіб якісного та кількісного визначення вмісту біфідобактерій Bifidobacterium longum subsp. longum за допомогою специфічних праймерів методом полімеразної ланцюгової реакції реального часу, який відрізняється тим, що використовують праймери В. lonF 5'-TTTCTATTGAACAGACACAGGTTTGCCC-3' та В. lonR 5'-AAACTGATTTGCCGATTTTGCC-3', які дозволяють ампліфікувати ділянку CRISPR довжиною 268 пар нуклеотидів (1807…2074) В. longum subsp. longum, яка...

Спосіб визначення культур lactobacillus delbrueckii subsp. bulgaricus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 112951

Опубліковано: 10.11.2016

Автори: Семенівська Олена Анатоліївна, Жукова Ярослава Фрідріхівна, Науменко Оксана Василівна, Вакуленко Микола Михайлович

МПК: C12N 15/11, C12Q 1/68, C12Q 1/04 ...

Мітки: методом, пари, реакції, спосіб, олігонуклеотидних, допомогою, lactobacillus, delbrueckii, subsp, bulgaricus, полімеразної, культур, визначення, праймерів, ланцюгової, специфічних

Формула / Реферат:

Спосіб визначення культур Lactobacillus delbrueckii subsp. bulgaricus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культур Lactobacillus delbrueckii subsp. bulgaricus використовують пари олігонуклеотидних...

Спосіб виявлення генетично модифікованої сої методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 111914

Опубліковано: 24.06.2016

Автори: Вакуленко Микола Михайлович, Жукова Ярослава Фрідріхівна, Семенівська Олена Анатоліївна

МПК: C12Q 1/68, C12N 15/11, C12Q 1/04 ...

Мітки: виявлення, модифікованої, методом, генетично, сої, полімеразної, реакції, ланцюгової, спосіб

Формула / Реферат:

Спосіб виявлення генетично модифікованої сої у сировині та харчових продуктах методом полімеразної ланцюгової реакції, при якому застосовують пари праймерів, специфічних до маркерів: видоспецифічного гена Lectin сої Glycine max, який кодує білок лектин; гена CP4-EPSPS, з Agrobacterium tumefaciens, який кодує 5-енолпірувілшикімат-3-фосфатсинтазу; трансформаційної події GTS 40-3-2; промотору 35S з...

Спосіб визначення культур streptococcus thermophilus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 111130

Опубліковано: 25.03.2016

Автори: Мудрак Тетяна Петрівна, Жукова Ярослава Фрідріхівна, Науменко Оксана Василівна, Чуманська Ганна Сергіївна, Вакуленко Микола Михайлович

МПК: C12Q 1/68, C12Q 1/04, C12N 15/11 ...

Мітки: методом, спосіб, thermophilus, streptococcus, праймерів, олігонуклеотидних, пари, допомогою, специфічних, культур, реакції, визначення, ланцюгової, полімеразної

Формула / Реферат:

Спосіб визначення культур Streptococcus thermophilus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культур Streptococcus thermophilus використовують пари олігонуклеотидних праймерів до гена pbp2b:прямий праймер Stt F 5'-CAGCCGAAACCTATGCAACA-3' 20 bр...

Спосіб ідентифікації dipylidium caninum у популяції собак за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 103721

Опубліковано: 25.12.2015

Автори: Пономаренко Володимир Якович, Лаптій Олена Петрівна, Приходько Олена Юріївна, Кульшин Володимир Євгенович, Приходько Юрій Олександрович

МПК: C12Q 1/68, C12N 15/10

Мітки: спосіб, dipylidium, полімеразної, ідентифікації, допомогою, caninum, собак, реакції, популяції, ланцюгової

Формула / Реферат:

Спосіб ідентифікації Dipylidium caninum у популяції собак за допомогою полімеразної ланцюгової реакції, що включає проведення ПЛР, пробопідготовку, ампліфікацію, детекцію ампліфікаційної ДНК, який відрізняється тим, що використовують ДНК ген 12S рРНК, який складається з таких послідовностей пар праймерів:5’ - CAGCAAGTGAATCCGTTCAG-3’5’ – GCATCAAAACTCTAATAAGCAGCA-3’.

Спосіб виявлення днк yersinia enterocolitica за допомогою “напівгніздового” методу полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 103102

Опубліковано: 10.12.2015

Автори: Виговська Лілія Миколаївна, Дерябін Олег Миколайович, Головко Анатолій Миколаєвич, Мачуський Олександр Вікторович, Поліщук Наталія Миколаївна, Ушкалов Артем Валерійович

МПК: A61K 31/00, G01N 33/00, C12Q 1/00 ...

Мітки: методу, enterocolitica, реакції, спосіб, днк, ланцюгової, допомогою, yersinia, виявлення, напівгніздового, полімеразної

Формула / Реферат:

Спосіб виявлення ДНК бактерії YERSINIA ENTEROCOLITICA за допомогою полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) збудника за допомогою "напівгніздового" варіанта полімеразної ланцюгової реакції (ПЛР) - ферментативної реакції і трьох штучно синтезованих олігонуклеотидних праймерів, які дозволяють багаторазово копіювати специфічні ділянки ДНК...

Спосіб виявлення днк патогенних лептоспір роду leptospira, виду leptospira interrogans у клінічному і патологічному матеріалі та зразках води за допомогою полімеразної ланцюгової реакції у режимі реального часу

Завантаження...

Номер патенту: 101190

Опубліковано: 25.08.2015

Автори: Куликова Влада Вячеславівна, Уховський Віталій Вікторович, Кучерявенко Олександр Олександрович

МПК: C07K 14/20

Мітки: матеріали, зразках, води, ланцюгової, часу, спосіб, leptospira, роду, виявлення, лептоспір, виду, режимі, допомогою, реального, патогенних, патологічному, interrogans, полімеразної, реакції, днк, клінічному

Формула / Реферат:

Спосіб виявлення ДНК патогенних лептоспір роду Leptospira, виду Leptospira interrogans у клінічному і патологічному матеріалі та зразках води за допомогою полімеразної ланцюгової реакції у реальному часі (ПЛР-РЧ), який здійснюють за допомогою специфічних фрагментів нуклеїнових кислот (ДНК) та гібридизаційно-флуоресценції детекції продуктів ампліфікації у режимі реального часу, який відрізняється тим, що результат ампліфікації ДНК патогенних...

Спосіб виявлення днк бактерії coxiella burnetii збудника ку-лихоманки за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 100232

Опубліковано: 10.07.2015

Автори: Марущак Людмила Василівна, Неволько Олег Михайлович, Головко Анатолій Миколайович, Дерябін Олег Миколайович

МПК: C12Q 1/68

Мітки: ку-лихоманки, coxiella, спосіб, збудника, днк, burnetii, ланцюгової, бактерії, допомогою, виявлення, полімеразної, реакції

Формула / Реферат:

Спосіб виявлення ДНК бактерії Coxiella burnetii збудника Ку-лихоманки за допомогою полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (НК) гену соm l, який кодує висококонсервативний білок зовнішньої мембрани з М.м 27kDа збудника Ку-лихоманки за допомогою полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно...

Спосіб детекції dirofilaria imitis та dirofilaria repens у біологічних зразках за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 98472

Опубліковано: 27.04.2015

Автори: Приходько Олена Юріївна, Симоненко Василь Іванович, Кульшин Володимир Євгенович, Михайличенко Олена Миколаївна, Решетило Олександр Іванович, Приходько Юрій Олександрович, Нікіфорова Ольга Василівна, Тригубенко Вікторія Василівна

МПК: C12Q 1/68

Мітки: полімеразної, repens, ланцюгової, dirofilaria, imitis, детекції, реакції, допомогою, спосіб, біологічних, зразках

Формула / Реферат:

Спосіб детекції Dirofilaria imitis та Dirofilaria repens у біологічних зразках за допомогою полімеразної ланцюгової реакції, що включає проведення ПЛР, підготовку буферу, ампліфікацію, детекцію ампліфікаційної ДНК, який відрізняється тим, що використовують гени-мішені 12S рРНК, що містить такі послідовності пар праймерів:5 '-tttttgaccgggtttagtacc-3'5 '-tgtgccaataaaattcaccaa-3'Розмір продукту 152 п.н. для Dirofilaria...

Спосіб визначення днк культури lactococcus lactis subsp. lactis за допомогою специфічних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107897

Опубліковано: 25.02.2015

Автори: Король Цвітана Олександрівна, Вакуленко Микола Михайлович, Малова Валерія Всеволодівна, Науменко Оксана Василівна, Жукова Ярослава Фрідріхівна

МПК: C12N 15/00

Мітки: допомогою, спосіб, реакції, subsp, lactococcus, lactis, методом, специфічних, ланцюгової, днк, культури, праймерів, полімеразної, визначення

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. lactic за допомогою специфічних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культури Lactococcus lactis subsp. lactis, використовують пару олігонуклеотидних праймерів до гену асmА N-ацетилмурамідази:прямий...

Спосіб визначення днк культури lactococcus lactis subsp. cremoris методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107547

Опубліковано: 12.01.2015

Автори: Вакуленко Микола Михайлович, Семенівська Олена Анатоліївна, Малова Валерія Всеволодівна

МПК: C12N 15/09

Мітки: методом, реакції, полімеразної, lactis, культури, днк, спосіб, lactococcus, subsp, визначення, ланцюгової, cremoris

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. cremoris у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції,який відрізняється тим, що для визначення ДНК культур Lactococcus lactis subsp. cremoris, застосовують пару олігонуклеотидних праймерів до гену recN DNA repair protein:прямий праймер

Спосіб визначення днк культури lactococcus lactis subsp. lactis методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107546

Опубліковано: 12.01.2015

Автори: Малова Валерія Всеволодівна, Семенівська Олена Анатоліївна, Вакуленко Микола Михайлович

МПК: C12N 15/09

Мітки: визначення, методом, ланцюгової, днк, спосіб, subsp, lactococcus, lactis, реакції, культури, полімеразної

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. lactic у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції, який відрізняється тим, що для визначення ДНК культури Lactococcus lactis subsp. lactis застосовують пару олігонуклеотидних праймерів до гену recN DNA repair protein:прямий праймер recN F: 5'- CAGGCTGAAGAAATTGAAGC-3' 20 bp тазворотній праймер recN R: 5'-...

Спосіб виявлення рнк вірусу чуми м’ясоїдних за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 94267

Опубліковано: 10.11.2014

Автори: Карпуленко Максим Сергійович, Головко Оксана Анатольївна, Кацимон Вадим Васильович, Дерябін Олег Миколайович

МПК: C12N 15/00, C07K 14/08, G01N 33/569 ...

Мітки: рнк, спосіб, полімеразної, вірусу, чуми, виявлення, м'ясоїдних, зворотно-транскриптазної, реакції, допомогою, ланцюгової

Формула / Реферат:

Спосіб виявлення РНК вірусу чуми м'ясоїдних за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (РНК) за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції (ЗТ-ПЛР), який відрізняється тим, що для проведення ЗТ-ПЛР використовують розроблені, штучно синтезовані, олігонуклеотидні праймери з наступною послідовністю...

Спосіб визначення культури lactococcus lactis subsp. cremoris за допомогою специфічних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 105349

Опубліковано: 25.04.2014

Автори: Вакуленко Микола Михайлович, Науменко Оксана Василівна, Король Цвітана Олександрівна, Малова Валерія Всеволодівна, Жукова Ярослава Фрідріхівна

МПК: C12N 15/09

Мітки: методом, lactis, праймерів, специфічних, ланцюгової, cremoris, lactococcus, культури, визначення, полімеразної, реакції, допомогою, subsp, спосіб

Формула / Реферат:

Спосіб визначення культури Lactococcus lactis subsp. cremoris за допомогою специфічних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культури Lactococcus lactis subsp. сremoris використовують пару олігонуклеотидних праймерів до гену асmА N-ацетилмурамідази: прямий...

Спосіб визначення днк культур lactococcus lactis subsp. lactic та lactococcus lactis subsp. cremoris методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 105310

Опубліковано: 25.04.2014

Автори: Семенівська Олена Анатоліївна, Малова Валерія Всеволодівна, Вакуленко Микола Михайлович

МПК: C12N 15/09

Мітки: методом, полімеразної, subsp, культур, днк, lactis, визначення, реакції, lactic, спосіб, cremoris, lactococcus, ланцюгової

Формула / Реферат:

Спосіб визначення ДНК культур Lactococcus lactis subsp. lactic та Lactococcus lactis subsp. cremoris у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції, які відрізняються тим, що для визначення ДНК культур Lactococcus lactis subsp. lactis та Lactococcus lactis subsp. cremoris, застосовують пари олігонуклеотидних праймерів до гену recN...

Спосіб детекції трансформаційної події gt73 ріпаку методом мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 88203

Опубліковано: 11.03.2014

Автори: Степаненко Олена Василівна, Степаненко Антон Ігорович, Моргун Богдан Володимирович

МПК: C12N 15/00

Мітки: ріпаку, детекції, методом, події, спосіб, трансформаційної, мультиплексної, полімеразної, реакції, ланцюгової

Формула / Реферат:

Спосіб детекції трансформаційної події ріпаку GT73 в генетично модифікованій рослині методом мультиплексної полімеразної ланцюгової реакції, для здійснення якого проводять денатурацію рослинної ДНК; цикли, кожен з яких включає денатурацію ДНК, ренатурацію рослинної ДНК з олігонуклеотидними праймерами, синтез фрагментів цільових генів; синтез фрагментів цільових генів, який відрізняється тим, що для проведення мультиплексної полімеразної...

Спосіб диференційної діагностики ентеритів гусей з використанням дуплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 87312

Опубліковано: 10.02.2014

Автори: Білецька Ганна Василівна, Кулібаба Роман Олександрович, Терещенко Олександр Володимирович, Юрко Поліна Сергіївна

МПК: C12Q 1/70

Мітки: ланцюгової, полімеразної, гусей, дуплексної, використанням, диференційної, спосіб, діагностики, реакції, ентеритів

Формула / Реферат:

Спосіб диференційної діагностики ентеритів гусей різної вірусної етіології, що включає ідентифікацію фрагментів геномів збудників ентеритів гусей за допомогою полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що проводять дуплексну ПЛР в "одній пробірці", у результаті якої можливе одночасне визначення фрагментів геномів парвовірусу та поліомавірусу, що дозволяє розрізнити захворювання, симптомокомплекси яких...

Спосіб визначення однонуклеотидного поліморфізму g28197a>g гена еластину методом алель-специфічної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 85434

Опубліковано: 25.11.2013

Автори: Шликова Оксана Анатоліївна, Скрипник Володимир Михайлович, Кайдашев Ігор Петрович, Воровський Олег Олегович, Аветіков Давид Соломонович, Весніна Людмила Едуардівна

МПК: A61B 5/00, G01N 1/00

Мітки: поліморфізму, еластину, гена, g28197a>g, алель-специфічної, спосіб, ланцюгової, однонуклеотидного, визначення, реакції, полімеразної, методом

Формула / Реферат:

Спосіб визначення однонуклеотидного поліморфізму g28197A>G гена еластину методом алель-специфічної полімеразної ланцюгової реакції, що включає визначення наявності поліморфних алелей А та G, який відрізняється тим, що одночасно виявляється наявність "дикої" та мутантної алелі за допомогою полімеразної ланцюгової реакції з парою алель-специфічних праймерів та парою специфічних проб, мічених флуоресцентними барвниками FAM і R6G з...

Спосіб визначення культур penicillium candidum та geotrichum candidum методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 101938

Опубліковано: 13.05.2013

Автори: Малова Валерія Всеволодівна, Жукова Ярослава Фрідріхівна, Вакуленко Микола Михайлович, Семенівська Олена Анатоліївна

МПК: C12N 15/11, C12Q 1/68

Мітки: визначення, методом, penicillium, полімеразної, спосіб, ланцюгової, geotrichum, культур, candidum, реакції

Формула / Реферат:

Спосіб визначення культур Penicillium candidum та Geotrichum candidum у м'яких сичужних сирах методом полімеразної ланцюгової реакції, який відрізняється тим, що для ідентифікації фрагмента ДНК-культур Penicillium candidum застосовують пару синтетичних олігонуклеотидних праймерів:прямий праймер gapdhF 5'-CGCCAATCTGCCGTAGGCCAT-3'та зворотній праймер gapdhR...

Спосіб детекції трансформаційної події кукурудзи mon810 методом мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 77769

Опубліковано: 25.02.2013

Автори: Моргун Богдан Володимирович, Марковський Олексій Вікторович, Федоренко Тетяна Валеріївна, Банникова Марія Олександрівна

МПК: C12N 15/31, C12N 15/32, C12N 15/82 ...

Мітки: події, мультиплексної, детекції, полімеразної, спосіб, реакції, трансформаційної, mon810, ланцюгової, методом, кукурудзи

Формула / Реферат:

Спосіб детекції трансформаційної події кукурудзи MON810 в генетично модифікованій рослині методом мультиплексної полімеразної ланцюгової реакції, для здійснення якого проводять денатурацію рослинної ДНК; цикли, кожен з яких включає денатурацію ДНК, ренатурацію рослинної ДНК з олігонуклеотидними праймерами, синтез фрагментів цільових генів; кінцевий синтез фрагментів цільових генів, який відрізняється тим, що для проведення мультиплексної...

Спосіб детекції трансформаційної події кукурудзи nk603 методом мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 77768

Опубліковано: 25.02.2013

Автори: Марковський Олексій Вікторович, Федоренко Тетяна Валеріївна, Моргун Богдан Володимирович, Банникова Марія Олександрівна

МПК: C12N 15/82, C12N 15/31, C12P 19/34 ...

Мітки: ланцюгової, спосіб, полімеразної, трансформаційної, кукурудзи, детекції, реакції, мультиплексної, nk603, методом, події

Формула / Реферат:

Спосіб детекції трансформаційної події кукурудзи NK603 в генетично модифікованій рослині методом мультиплексної полімеразної ланцюгової реакції, для здійснення якого проводять денатурацію рослинної ДНК; цикли, кожен з яких включає денатурацію ДНК, ренатурацію рослинної ДНК з олігонуклеотидними праймерами, синтез фрагментів цільових генів; кінцевий синтез фрагментів цільових генів, який відрізняється тим, що для проведення мультиплексної...

Спосіб діагностики мvx методом мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 68996

Опубліковано: 25.04.2012

Автори: Іванова Тетяна Василівна, Антіпов Ігор Олександрович, Мельничук Максим Дмитрович

МПК: C12Q 1/68

Мітки: діагностики, ланцюгової, спосіб, полімеразної, методом, мультиплексної, реакції

Формула / Реферат:

Спосіб діагностики MVX методом мультиплексної полімеразної ланцюгової реакції, що включає відбір зразків, екстракцію длРНК із зразків, реакцію зворотної транскрипції, проведення полімеразної ланцюгової реакції (ПЛР), візуалізацію та аналіз результатів, який відрізняється тим, що для проведення ПЛР використовується дві пари праймерів, одна пара АВ 18s_fl TAGGATAGAGGCCTACCA і АВ 18s_rl TTCGCAGTAGTCGGTCTTGA специфічна до послідовності до 18S...

Спосіб використання мультиплексної полімеразної ланцюгової реакції для визначення пародонтопатогенної флори

Завантаження...

Номер патенту: 65337

Опубліковано: 12.12.2011

Автори: Весніна Людмила Едуардівна, Боброва Нелля Олександрівна, Ізмайлова Ольга Ваталіївна, Кайдашев Ігор Петрович, Шликова Оксана Анатоліївна

МПК: G01N 33/00

Мітки: пародонтопатогенної, флори, мультиплексної, визначення, полімеразної, реакції, використання, ланцюгової, спосіб

Формула / Реферат:

Спосіб використання мультиплексної полімеразної ланцюгової реакції для визначення наявності та співвідношення окремих мікроорганізмів, який відрізняється тим, що визначення проводять в порожнині рота, як мікроорганізми визначають - Lactobacillus spp./BK, Enterobacterium spp., Streptococcus spp., Gardnerella vaginalis/Prevotella bivia/Porphyromonas spp., Eubacterium spp., Mycoplasma genitalium+hominis, Candida spp.., а полімеразну ланцюгову...

Спосіб екстракції днк з матеріалу рослинного походження для генетичного аналізу за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 62611

Опубліковано: 12.09.2011

Автори: Герілович Антон Павлович, Стегній Борис Тимофійович, Солодянкін Олексій Сергійович, Сапко Світлана Анатоліївна

МПК: C12N 7/00

Мітки: спосіб, аналізу, днк, екстракції, допомогою, реакції, походження, генетичного, рослинного, полімеразної, матеріалу, ланцюгової

Формула / Реферат:

Спосіб екстракції ДНК з матеріалу рослинного походження для генетичного аналізу за допомогою полімеразної ланцюгової реакції, що включає лізис клітин бромистим цетилтриметиламонієм, сорбцію ДНК на діоксид кремнію, дворазове відмивання діоксиду кремнію 70 % етанолом, який відрізняється тим, що на кінцевій стадії відмивання використовують хлороформ з ізопропанолом.

Спосіб екстракції днк з крові хребетних для генетичного аналізу за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 62610

Опубліковано: 12.09.2011

Автори: Стегній Борис Тимофійович, Герілович Антон Павлович, Солодянкін Олексій Сергійович

МПК: C12N 7/00

Мітки: екстракції, ланцюгової, днк, хребетних, крові, реакції, генетичного, полімеразної, спосіб, допомогою, аналізу

Формула / Реферат:

Спосіб екстракції ДНК з крові хребетних для генетичного аналізу за допомогою полімеразної ланцюгової реакції, що включає лізис еритроцитів, сорбцію ДНК на діоксид кремнію, центрифугування та відмивання ДНК, який відрізняється тим, що на етапі селективного лізису еритроцитів використовують розчин хлориду амонію, калію гідрокарбонату.

Спосіб екстракції днк з тканин тваринного походження для генетичного аналізу за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 62609

Опубліковано: 12.09.2011

Автори: Сапко Світлана Анатоліївна, Солодянкін Олексій Сергійович, Стегній Борис Тимофійович, Герілович Антон Павлович

МПК: C12N 7/00

Мітки: реакції, походження, аналізу, днк, спосіб, тваринного, полімеразної, генетичного, допомогою, екстракції, тканин, ланцюгової

Формула / Реферат:

Спосіб екстракції ДНК з тканин тваринного походження для генетичного аналізу за допомогою полімеразної ланцюгової реакції, що включає ферментативний метод дезінтеграції тканин, який відрізняється тим, що для протеолітичної обробки використовують розчин трипсину, фільтрують клітини від грубих механічних домішок, лізують клітини гуанідином тіоціанатом, сорбцію ДНК проводять на діоксиді кремнію та дворазово відмивають діоксид кремнію 70 %...

Спосіб визначення трансгенної лінії ga21 кукурудзи за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 61602

Опубліковано: 25.07.2011

Автори: Банникова Марія Олександрівна, Кучук Микола Вікторович, Борисова Вікторія Вікторівна, Моргун Богдан Володимирович, Сатарова Тетяна Миколаївна

МПК: C12N 15/00

Мітки: полімеразної, реакції, трансгенної, ланцюгової, допомогою, кукурудзи, визначення, спосіб, лінії

Формула / Реферат:

Спосіб детекції мутантного гена 5-енолпірувіл шікімат-3-фосфат синтази кукурудзи (Zea mays L.) у генетично модифікованій рослині методом полімеразної ланцюгової реакції, для здійснення якої проводять термальну денатурацію рослинної ДНК; циклічну ампліфікацію, де кожен цикл включає денатурацію ДНК, ренатурацію рослинної ДНК з олігонуклеотидними праймерами, синтез фрагментів цільових генів; синтез фрагментів цільових генів, для проведення...

Спосіб виявлення плазмід pхо1 та pхо2 в складі бактерій bacillus anthracis за допомогою мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 55775

Опубліковано: 27.12.2010

Автори: Дерябін Олег Миколайович, Дерябіна Олена Григорівна, Скрипнік Артем Валерійович, Бєднов Максим Олександрович

МПК: A61K 39/27

Мітки: anthracis, допомогою, ланцюгової, складі, бактерій, pхо2, полімеразної, виявлення, bacillus, плазмід, pхо1, мультиплексної, реакції, спосіб

Формула / Реферат:

Спосіб виявлення ДНК плазмід рХО1 та рХО2 в складі бактерій Bacillus anthracis, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) за допомогою мультиплексного варіанту полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно синтезовані олігонуклеотидні праймери з наступною послідовністю нуклеотидів:для плазміди рХО1 (ген протективного...

Спосіб виявлення рнк вірусу геморагічної септицемії форелі за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 54336

Опубліковано: 10.11.2010

Автори: Бабкін Михайло Валерійович, Дерябін Олег Миколайович, Гайдей Ольга Сергіївна, Головко Анатолій Миколайович, Ушкалов Валерій Олександрович

МПК: A61K 39/39

Мітки: виявлення, допомогою, спосіб, форелі, вірусу, геморагічної, зворотно-транскриптазної, полімеразної, рнк, ланцюгової, септицемії, реакції

Формула / Реферат:

Спосіб виявлення РНК вірусу геморагічної септицемії форелі за допомогою полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (РНК) за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції (ЗТ-ПЛР), який відрізняється тим, що для проведення ЗТ-ПЛР використовують штучно синтезовані вироджені олігонуклеотидні праймери з наступною послідовністю...

Спосіб ідентифікації giardia intestinalis у популяції собак за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 53593

Опубліковано: 11.10.2010

Автори: Приходько Юрій Олександрович, Кульшин Володимир Євгенович, Пономаренко Володимир Якович, Булавіна Вікторія Сергіївна

МПК: C12Q 1/68

Мітки: спосіб, собак, giardia, полімеразної, допомогою, реакції, ідентифікації, ланцюгової, популяції, intestinalis

Формула / Реферат:

Спосіб ідентифікації Giardia intestinalis у популяції собак за допомогою полімеразної ланцюгової реакції, що включає проведення ПЛР, пробопідготовку, ампліфікацію, детекцію ампліфікаційної ДНК, який відрізняється тим, що використовують ДНК ген бетагіардину, який складається з таких послідовностей пар праймерів:5'-CAGCGCGTCAGCAGGTTCCA5' -GGGCCTCCTTCCTGAGGGCT.

Спосіб виявлення рнк вірусу сказу за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 52924

Опубліковано: 10.09.2010

Автори: Бабкін Михайло Валерійович, Дерябін Олег Миколайович, Головко Максим Анатолійович, Ушкалов Валерій Олександрович

МПК: A61K 39/205

Мітки: реакції, рнк, сказу, допомогою, вірусу, виявлення, полімеразної, спосіб, зворотно-транскриптазної, ланцюгової

Формула / Реферат:

Спосіб виявлення РНК вірусу сказу за допомогою полімеразної ланцюгової реакції (ПЛР), що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (РНК) за допомогою "гніздового" варіанта зворотно-транскриптазної полімеразної ланцюгової реакції (ЗТ-ПЛР), який відрізняється тим, що для проведення ПЛР на першому етапі використовують штучно синтезовані олігонуклеотидні праймери з наступною послідовністю...

Спосіб детекції рекомбінантного гена ацил-ліпідної десатурази, злитої з термостабільною ліхеназою, в генетично модифікованій рослині методом мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 51842

Опубліковано: 10.08.2010

Автори: Бєрдічєвєц Іріна Ніколаєвна, Шелудько Юрій Всеволодович, Герасименко Ірина Михайлівна, Шімшілашвілі Хрістіна Романовна, Голдєнкова-Павлова Іріна Васільєвна, Сіндаровська Яна Рудольфівна

МПК: C12Q 1/68, C12N 15/00, C12Q 1/25 ...

Мітки: методом, модифікований, ланцюгової, ацил-ліпідної, ліхеназою, спосіб, детекції, мультиплексної, генетично, рослини, гена, злито, полімеразної, термостабільною, рекомбінантного, десатурази, реакції

Формула / Реферат:

Спосіб детекції рекомбінантного гена ацил-ліпідної десатурази, злитої з термостабільною ліхеназою, в генетично модифікованій рослині методом мультиплексної полімеразної ланцюгової реакції, для здійснення якого проводять денатурацію рослинної ДНК; цикли, кожен з яких включає денатурацію ДНК, ренатурацію рослинної ДНК з олігонуклеотидними праймерами, синтез фрагментів цільових генів, який відрізняється тим, що для проведення мультиплексної...