Патенти з міткою «полімеразної»

Спосіб диференційної діагностики африканської та класичної чуми свиней методом дуплексної полімеразної ланцюгової реакції у режимі реального часу

Завантаження...

Номер патенту: 122578

Опубліковано: 10.01.2018

Автори: Галка Ігор Васильович, Ничик Сергій Анатолійович, Ситюк Микола Петрович, Музикіна Лариса Миколаївна, Мандигра Світлана Станіславівна, Коваленко Ганна Андріївна, Іщенко Людмила Мар'янівна, Спиридонов Владислав Генадійович, Мельничук Сергій Дмитрович

МПК: G01N 33/48

Мітки: часу, полімеразної, дуплексної, діагностики, класичної, ланцюгової, методом, африканської, диференційної, режимі, реального, реакції, спосіб, свиней, чуми

Формула / Реферат:

Спосіб диференційної діагностики африканської та класичної чуми свиней (АЧС та КЧС) методом дуплексної полімеразної ланцюгової реакції у режимі реального часу, що включає ідентифікацію цільових ділянок гена B646L вірусу АЧС та 5' UTR вірусу КЧС, який відрізняється тим, що ампліфікація проводиться одночасно в одній пробірці з використанням двох пар специфічних праймерів: 1) для АЧС - ASF F (5' CTG СТС ATG GTA ТСА АТС ТТА TCG А 3') та ASF R...

Спосіб полімеразної ланцюгової реакції у режимі реального часу для діагностики африканської чуми свиней

Завантаження...

Номер патенту: 116390

Опубліковано: 25.05.2017

Автори: Ничик Сергій Анатолійович, Спиридонов Владислав Геннадієвич, Ситюк Микола Петрович, Галка Ігор Васильович

МПК: G01N 33/535, A61K 39/187

Мітки: чуми, діагностики, полімеразної, часу, режимі, спосіб, реакції, ланцюгової, свиней, реального, африканської

Формула / Реферат:

Спосіб полімеразної ланцюгової реакції у режимі реального часу для діагностики африканської чуми свиней, що призначений для виявлення в патологічному матеріалі (фрагменти лімфоїдних, паранхіматозних органів, тканин) ДНК вірусу АЧС шляхом приготування суспензії з патологічного субстрату, виділенням нуклеїнової кислоти та її ампліфікації, який відрізняється тим, що детекцію ДНК вірусу АЧС здійснюють за специфічною ділянкою гена, що кодує...

Спосіб визначення культур lactobacillus casei, lactobacillus paracasei та lactobacillus paracasei subsp. paracasei за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 114260

Опубліковано: 10.05.2017

Автори: Мудрак Тетяна Петрівна, Вакуленко Микола Михайлович, Науменко Оксана Василівна, Петров Пилип Ігорович, Жукова Ярослава Фрідріхівна

МПК: C12Q 1/68, C12Q 1/04, C12N 15/11 ...

Мітки: пари, методом, subsp, олігонуклеотидних, реакції, полімеразної, визначення, культур, casei, lactobacillus, допомогою, праймерів, специфічних, ланцюгової, paracasei, спосіб

Формула / Реферат:

Спосіб визначення культур Lactobacillus casei, Lactobacillus paracasei та Lactobacillus paracasei subsp. paracasei за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції у заквашувальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культур Lactobacillus casei,...

Спосіб ідентифікації шиготоксинутворюючих генів (stx1/stx2) escherichia coli методом полімеразної ланцюгової реакції в реальному часі

Завантаження...

Номер патенту: 115879

Опубліковано: 25.04.2017

Автори: Спиридонов Владислав Генадійович, Мачуський Олександр Вікторович, Виговська Лілія Миколаївна, Мазур Тетяна Василівна, Ушкалов Валерій Олександрович, Стародуб Микола Федорович, Іщенко Людмила Мар'янівна, Новгородова Олександра Юріївна

МПК: G01N 29/24, G01N 30/04, C12R 1/19 ...

Мітки: методом, ідентифікації, escherichia, ланцюгової, шиготоксинутворюючих, реальному, спосіб, реакції, часі, полімеразної, генів

Формула / Реферат:

Спосіб ідентифікації шиготоксиноутворюючих генів (stxl і stx2) Escherichia coli методом полімеразної ланцюгової реакції в реальному часі, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) ентерогеморагічних ешерихій за допомогою ферментативної реакції з шістьма штучно синтезованими олігонуклеотидними ланцюгами, які багаторазово копіюють специфічні ділянки ДНК інфекційного агента при певних...

Спосіб якісного та кількісного визначення видового складу багатокомпонентних бактеріальних препаратів за допомогою специфічних праймерів методом полімеразної ланцюгової реакції реального часу

Завантаження...

Номер патенту: 115774

Опубліковано: 25.04.2017

Автори: Шевченко Любов Миколаївна, Літовченко Олександр Вікторович, Шевченко Тетяна Вікторівна, Димент Галина Семенівна, Коробка Вадим Леонідович, Кітам Володимир Олегович, Янковський Дмитро Станіславович

МПК: C12N 1/20, C12R 1/01

Мітки: спосіб, багатокомпонентних, методом, праймерів, складу, часу, препаратів, реального, полімеразної, ланцюгової, видового, якісного, реакції, визначення, допомогою, кількісного, бактеріальних, специфічних

Формула / Реферат:

Спосіб якісного та кількісного визначення видового складу багатокомпонентного бактеріального препарату, щомістить представників родів Bifidobacterium, Lactobacillus, Propionibacterium, Lactococcus, Streptococcus та Acetobacter, за допомогою специфічних праймерів методом полімеразної ланцюгової реакції в режимі реального часу, який відрізняється тим, що визначають склад бактеріального препарату на рівні видів Lactobacillus acidophilus,...

Спосіб індикації salmonella spp. методом полімеразної ланцюгової реакції в реальному часі

Завантаження...

Номер патенту: 115440

Опубліковано: 10.04.2017

Автори: Іщенко Людмила Мар'янівна, Спиридонов Владислав Генадійович, Ушкалов Валерій Олександрович, Виговська Лілія Миколаївна, Стародуб Микола Федорович, Мазур Тетяна Василівна, Новгородова Олександра Юріївна, Мачуський Олександр Вікторович

МПК: C12Q 1/12, G01N 29/24, C12R 1/42 ...

Мітки: реальному, спосіб, індикації, методом, реакції, часі, salmonella, полімеразної, ланцюгової

Формула / Реферат:

Спосіб індикації Salmonella spp. методом полімеразної ланцюгової реакції в реальному часі, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) мікроорганізмів роду Salmonella за допомогою ферментативної реакції і трьох штучно синтезованих олігонуклеотидних ланцюгів, які дозволяють багаторазово копіювати специфічні ділянки ДНК сальмонел при певних температурних і часових параметрах та кількості...

Спосіб детекції патогенних для людини бабезій за допомогою мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 115268

Опубліковано: 10.04.2017

Автори: Торянік Інна Іванівна, Чигиринська Ніла Анатоліївна, Похил Сергій Іванови, Казмірчук Віктор Володимирович, Білозоров Олексій Павлович, Круглова Тетяна Анатоліївна, Лець Вікторія Василівна, Тимченко Олена Миколаївна, Костиря Ірина Анатоліївна

МПК: A61K 35/68, G01N 33/50, C12Q 1/68 ...

Мітки: бабезій, допомогою, полімеразної, спосіб, реакції, ланцюгової, патогенних, мультиплексної, детекції, людини

Формула / Реферат:

Спосіб детекції патогенних для людини бабезій за допомогою мультиплексної полімеразної ланцюгової реакції (ПЛР), що включає виявлення специфічних ампліконів (копій фрагментів гену 18S rRNA Babesia microti, В. divergens + В. venatorum), попередньо одержаних за допомогою мультиплексної ПЛР, який відрізняється тим, що для відтворення реакції використовують праймери BabUnF, BabMicR і BabDivR із такою послідовністю нуклеотидів:BabUnF 5' -...

Спосіб виявлення рнк вірусу хвороби тешена свиней методом полімеразної ланцюгової реакції в режимі реального часу

Завантаження...

Номер патенту: 114872

Опубліковано: 27.03.2017

Автори: Спиридонов Владислав Генадійович, Музикіна Лариса Миколаївна, Іщенко Людмила Мар'янівна, Галка Ігор Васильович, Ситюк Микола Петрович

МПК: G01N 33/569

Мітки: реального, свиней, виявлення, хвороби, ланцюгової, часу, спосіб, реакції, полімеразної, методом, вірусу, режимі, тешена, рнк

Формула / Реферат:

Спосіб виявлення РНК вірусу хвороби Тешена свиней методом полімеразної ланцюгової реакції в режимі реального часу (ПЛР-РЧ), що включає виділення в досліджуваній пробі РНК вірусу, отримання кДНК, який відрізняється тим, що ампліфікація специфічної ділянки кДНК здійснюється з використанням специфічних олігонуклеотидних праймерів з наступними послідовностями: PTV-1-F - 5'TCTGTTGCTGTGAGGGTAATG, PTV-1-R - 5'AGTCTTGTGCCTGTTCTATGG, а також...

Спосіб якісного та кількісного визначення вмісту біфідобактерій за допомогою специфічних праймерів методом полімеразної ланцюгової реакції реального часу

Завантаження...

Номер патенту: 112731

Опубліковано: 26.12.2016

Автори: Шевченко Тетяна Вікторівна, Шевченко Любов Миколаївна, Літовченко Олександр Вікторович, Коробка Вадим Леонідович, Кітам Володимир Олегович, Янковський Дмитро Станіславович, Димент Галина Семенівна

МПК: C12N 15/11, C12Q 1/68

Мітки: полімеразної, визначення, якісного, допомогою, специфічних, ланцюгової, вмісту, кількісного, спосіб, біфідобактерій, часу, реального, методом, реакції, праймерів

Формула / Реферат:

Спосіб якісного та кількісного визначення вмісту біфідобактерій Bifidobacterium longum subsp. longum за допомогою специфічних праймерів методом полімеразної ланцюгової реакції реального часу, який відрізняється тим, що використовують праймери В. lonF 5'-TTTCTATTGAACAGACACAGGTTTGCCC-3' та В. lonR 5'-AAACTGATTTGCCGATTTTGCC-3', які дозволяють ампліфікувати ділянку CRISPR довжиною 268 пар нуклеотидів (1807…2074) В. longum subsp. longum, яка...

Спосіб визначення культур lactobacillus delbrueckii subsp. bulgaricus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 112951

Опубліковано: 10.11.2016

Автори: Жукова Ярослава Фрідріхівна, Науменко Оксана Василівна, Семенівська Олена Анатоліївна, Вакуленко Микола Михайлович

МПК: C12Q 1/68, C12N 15/11, C12Q 1/04 ...

Мітки: bulgaricus, праймерів, культур, subsp, lactobacillus, ланцюгової, специфічних, олігонуклеотидних, полімеразної, визначення, пари, методом, допомогою, реакції, delbrueckii, спосіб

Формула / Реферат:

Спосіб визначення культур Lactobacillus delbrueckii subsp. bulgaricus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культур Lactobacillus delbrueckii subsp. bulgaricus використовують пари олігонуклеотидних...

Спосіб виявлення генетично модифікованої сої методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 111914

Опубліковано: 24.06.2016

Автори: Жукова Ярослава Фрідріхівна, Вакуленко Микола Михайлович, Семенівська Олена Анатоліївна

МПК: C12Q 1/04, C12Q 1/68, C12N 15/11 ...

Мітки: реакції, виявлення, методом, модифікованої, генетично, полімеразної, спосіб, ланцюгової, сої

Формула / Реферат:

Спосіб виявлення генетично модифікованої сої у сировині та харчових продуктах методом полімеразної ланцюгової реакції, при якому застосовують пари праймерів, специфічних до маркерів: видоспецифічного гена Lectin сої Glycine max, який кодує білок лектин; гена CP4-EPSPS, з Agrobacterium tumefaciens, який кодує 5-енолпірувілшикімат-3-фосфатсинтазу; трансформаційної події GTS 40-3-2; промотору 35S з...

Спосіб визначення культур streptococcus thermophilus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 111130

Опубліковано: 25.03.2016

Автори: Вакуленко Микола Михайлович, Жукова Ярослава Фрідріхівна, Науменко Оксана Василівна, Чуманська Ганна Сергіївна, Мудрак Тетяна Петрівна

МПК: C12Q 1/04, C12N 15/11, C12Q 1/68 ...

Мітки: streptococcus, олігонуклеотидних, культур, спосіб, допомогою, визначення, реакції, специфічних, методом, праймерів, ланцюгової, полімеразної, thermophilus, пари

Формула / Реферат:

Спосіб визначення культур Streptococcus thermophilus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культур Streptococcus thermophilus використовують пари олігонуклеотидних праймерів до гена pbp2b:прямий праймер Stt F 5'-CAGCCGAAACCTATGCAACA-3' 20 bр...

Спосіб ідентифікації dipylidium caninum у популяції собак за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 103721

Опубліковано: 25.12.2015

Автори: Приходько Юрій Олександрович, Пономаренко Володимир Якович, Приходько Олена Юріївна, Кульшин Володимир Євгенович, Лаптій Олена Петрівна

МПК: C12N 15/10, C12Q 1/68

Мітки: ланцюгової, собак, допомогою, ідентифікації, полімеразної, реакції, dipylidium, популяції, caninum, спосіб

Формула / Реферат:

Спосіб ідентифікації Dipylidium caninum у популяції собак за допомогою полімеразної ланцюгової реакції, що включає проведення ПЛР, пробопідготовку, ампліфікацію, детекцію ампліфікаційної ДНК, який відрізняється тим, що використовують ДНК ген 12S рРНК, який складається з таких послідовностей пар праймерів:5’ - CAGCAAGTGAATCCGTTCAG-3’5’ – GCATCAAAACTCTAATAAGCAGCA-3’.

Спосіб виявлення днк yersinia enterocolitica за допомогою “напівгніздового” методу полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 103102

Опубліковано: 10.12.2015

Автори: Виговська Лілія Миколаївна, Ушкалов Артем Валерійович, Поліщук Наталія Миколаївна, Дерябін Олег Миколайович, Головко Анатолій Миколаєвич, Мачуський Олександр Вікторович

МПК: C12Q 1/00, A61K 31/00, G01N 33/00 ...

Мітки: методу, напівгніздового, допомогою, виявлення, полімеразної, реакції, enterocolitica, спосіб, yersinia, днк, ланцюгової

Формула / Реферат:

Спосіб виявлення ДНК бактерії YERSINIA ENTEROCOLITICA за допомогою полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) збудника за допомогою "напівгніздового" варіанта полімеразної ланцюгової реакції (ПЛР) - ферментативної реакції і трьох штучно синтезованих олігонуклеотидних праймерів, які дозволяють багаторазово копіювати специфічні ділянки ДНК...

Спосіб виявлення днк патогенних лептоспір роду leptospira, виду leptospira interrogans у клінічному і патологічному матеріалі та зразках води за допомогою полімеразної ланцюгової реакції у режимі реального часу

Завантаження...

Номер патенту: 101190

Опубліковано: 25.08.2015

Автори: Кучерявенко Олександр Олександрович, Куликова Влада Вячеславівна, Уховський Віталій Вікторович

МПК: C07K 14/20

Мітки: реального, leptospira, днк, води, клінічному, часу, виду, interrogans, полімеразної, допомогою, спосіб, реакції, режимі, патологічному, лептоспір, виявлення, матеріали, роду, зразках, патогенних, ланцюгової

Формула / Реферат:

Спосіб виявлення ДНК патогенних лептоспір роду Leptospira, виду Leptospira interrogans у клінічному і патологічному матеріалі та зразках води за допомогою полімеразної ланцюгової реакції у реальному часі (ПЛР-РЧ), який здійснюють за допомогою специфічних фрагментів нуклеїнових кислот (ДНК) та гібридизаційно-флуоресценції детекції продуктів ампліфікації у режимі реального часу, який відрізняється тим, що результат ампліфікації ДНК патогенних...

Спосіб виявлення днк бактерії coxiella burnetii збудника ку-лихоманки за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 100232

Опубліковано: 10.07.2015

Автори: Дерябін Олег Миколайович, Неволько Олег Михайлович, Головко Анатолій Миколайович, Марущак Людмила Василівна

МПК: C12Q 1/68

Мітки: реакції, допомогою, спосіб, полімеразної, збудника, coxiella, бактерії, burnetii, виявлення, днк, ку-лихоманки, ланцюгової

Формула / Реферат:

Спосіб виявлення ДНК бактерії Coxiella burnetii збудника Ку-лихоманки за допомогою полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (НК) гену соm l, який кодує висококонсервативний білок зовнішньої мембрани з М.м 27kDа збудника Ку-лихоманки за допомогою полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно...

Спосіб детекції dirofilaria imitis та dirofilaria repens у біологічних зразках за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 98472

Опубліковано: 27.04.2015

Автори: Решетило Олександр Іванович, Кульшин Володимир Євгенович, Приходько Юрій Олександрович, Нікіфорова Ольга Василівна, Симоненко Василь Іванович, Тригубенко Вікторія Василівна, Приходько Олена Юріївна, Михайличенко Олена Миколаївна

МПК: C12Q 1/68

Мітки: детекції, dirofilaria, imitis, ланцюгової, зразках, repens, допомогою, реакції, полімеразної, спосіб, біологічних

Формула / Реферат:

Спосіб детекції Dirofilaria imitis та Dirofilaria repens у біологічних зразках за допомогою полімеразної ланцюгової реакції, що включає проведення ПЛР, підготовку буферу, ампліфікацію, детекцію ампліфікаційної ДНК, який відрізняється тим, що використовують гени-мішені 12S рРНК, що містить такі послідовності пар праймерів:5 '-tttttgaccgggtttagtacc-3'5 '-tgtgccaataaaattcaccaa-3'Розмір продукту 152 п.н. для Dirofilaria...

Спосіб визначення днк культури lactococcus lactis subsp. lactis за допомогою специфічних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107897

Опубліковано: 25.02.2015

Автори: Малова Валерія Всеволодівна, Науменко Оксана Василівна, Вакуленко Микола Михайлович, Жукова Ярослава Фрідріхівна, Король Цвітана Олександрівна

МПК: C12N 15/00

Мітки: специфічних, subsp, праймерів, реакції, визначення, днк, методом, допомогою, ланцюгової, lactis, спосіб, культури, полімеразної, lactococcus

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. lactic за допомогою специфічних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культури Lactococcus lactis subsp. lactis, використовують пару олігонуклеотидних праймерів до гену асmА N-ацетилмурамідази:прямий...

Спосіб визначення днк культури lactococcus lactis subsp. cremoris методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107547

Опубліковано: 12.01.2015

Автори: Малова Валерія Всеволодівна, Вакуленко Микола Михайлович, Семенівська Олена Анатоліївна

МПК: C12N 15/09

Мітки: cremoris, subsp, днк, lactis, lactococcus, полімеразної, культури, спосіб, методом, визначення, реакції, ланцюгової

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. cremoris у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції,який відрізняється тим, що для визначення ДНК культур Lactococcus lactis subsp. cremoris, застосовують пару олігонуклеотидних праймерів до гену recN DNA repair protein:прямий праймер

Спосіб визначення днк культури lactococcus lactis subsp. lactis методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107546

Опубліковано: 12.01.2015

Автори: Семенівська Олена Анатоліївна, Вакуленко Микола Михайлович, Малова Валерія Всеволодівна

МПК: C12N 15/09

Мітки: lactococcus, lactis, ланцюгової, культури, реакції, днк, визначення, полімеразної, спосіб, методом, subsp

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. lactic у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції, який відрізняється тим, що для визначення ДНК культури Lactococcus lactis subsp. lactis застосовують пару олігонуклеотидних праймерів до гену recN DNA repair protein:прямий праймер recN F: 5'- CAGGCTGAAGAAATTGAAGC-3' 20 bp тазворотній праймер recN R: 5'-...

Спосіб виявлення рнк вірусу чуми м’ясоїдних за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 94267

Опубліковано: 10.11.2014

Автори: Головко Оксана Анатольївна, Карпуленко Максим Сергійович, Кацимон Вадим Васильович, Дерябін Олег Миколайович

МПК: C07K 14/08, G01N 33/569, C12N 15/00 ...

Мітки: ланцюгової, м'ясоїдних, реакції, полімеразної, спосіб, допомогою, вірусу, зворотно-транскриптазної, чуми, виявлення, рнк

Формула / Реферат:

Спосіб виявлення РНК вірусу чуми м'ясоїдних за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (РНК) за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції (ЗТ-ПЛР), який відрізняється тим, що для проведення ЗТ-ПЛР використовують розроблені, штучно синтезовані, олігонуклеотидні праймери з наступною послідовністю...

Спосіб визначення культури lactococcus lactis subsp. cremoris за допомогою специфічних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 105349

Опубліковано: 25.04.2014

Автори: Жукова Ярослава Фрідріхівна, Вакуленко Микола Михайлович, Малова Валерія Всеволодівна, Науменко Оксана Василівна, Король Цвітана Олександрівна

МПК: C12N 15/09

Мітки: ланцюгової, lactis, допомогою, subsp, реакції, полімеразної, cremoris, визначення, методом, спосіб, праймерів, культури, специфічних, lactococcus

Формула / Реферат:

Спосіб визначення культури Lactococcus lactis subsp. cremoris за допомогою специфічних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культури Lactococcus lactis subsp. сremoris використовують пару олігонуклеотидних праймерів до гену асmА N-ацетилмурамідази: прямий...

Спосіб визначення днк культур lactococcus lactis subsp. lactic та lactococcus lactis subsp. cremoris методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 105310

Опубліковано: 25.04.2014

Автори: Семенівська Олена Анатоліївна, Малова Валерія Всеволодівна, Вакуленко Микола Михайлович

МПК: C12N 15/09

Мітки: визначення, полімеразної, lactis, культур, cremoris, lactococcus, ланцюгової, днк, методом, реакції, subsp, lactic, спосіб

Формула / Реферат:

Спосіб визначення ДНК культур Lactococcus lactis subsp. lactic та Lactococcus lactis subsp. cremoris у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції, які відрізняються тим, що для визначення ДНК культур Lactococcus lactis subsp. lactis та Lactococcus lactis subsp. cremoris, застосовують пари олігонуклеотидних праймерів до гену recN...

Спосіб детекції трансформаційної події gt73 ріпаку методом мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 88203

Опубліковано: 11.03.2014

Автори: Степаненко Антон Ігорович, Моргун Богдан Володимирович, Степаненко Олена Василівна

МПК: C12N 15/00

Мітки: реакції, ріпаку, полімеразної, трансформаційної, методом, мультиплексної, спосіб, події, детекції, ланцюгової

Формула / Реферат:

Спосіб детекції трансформаційної події ріпаку GT73 в генетично модифікованій рослині методом мультиплексної полімеразної ланцюгової реакції, для здійснення якого проводять денатурацію рослинної ДНК; цикли, кожен з яких включає денатурацію ДНК, ренатурацію рослинної ДНК з олігонуклеотидними праймерами, синтез фрагментів цільових генів; синтез фрагментів цільових генів, який відрізняється тим, що для проведення мультиплексної полімеразної...

Спосіб диференційної діагностики ентеритів гусей з використанням дуплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 87312

Опубліковано: 10.02.2014

Автори: Юрко Поліна Сергіївна, Білецька Ганна Василівна, Терещенко Олександр Володимирович, Кулібаба Роман Олександрович

МПК: C12Q 1/70

Мітки: використанням, дуплексної, полімеразної, спосіб, ланцюгової, гусей, диференційної, реакції, ентеритів, діагностики

Формула / Реферат:

Спосіб диференційної діагностики ентеритів гусей різної вірусної етіології, що включає ідентифікацію фрагментів геномів збудників ентеритів гусей за допомогою полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що проводять дуплексну ПЛР в "одній пробірці", у результаті якої можливе одночасне визначення фрагментів геномів парвовірусу та поліомавірусу, що дозволяє розрізнити захворювання, симптомокомплекси яких...

Спосіб визначення однонуклеотидного поліморфізму g28197a>g гена еластину методом алель-специфічної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 85434

Опубліковано: 25.11.2013

Автори: Воровський Олег Олегович, Шликова Оксана Анатоліївна, Кайдашев Ігор Петрович, Аветіков Давид Соломонович, Весніна Людмила Едуардівна, Скрипник Володимир Михайлович

МПК: G01N 1/00, A61B 5/00

Мітки: визначення, еластину, методом, полімеразної, g28197a>g, ланцюгової, реакції, однонуклеотидного, гена, алель-специфічної, поліморфізму, спосіб

Формула / Реферат:

Спосіб визначення однонуклеотидного поліморфізму g28197A>G гена еластину методом алель-специфічної полімеразної ланцюгової реакції, що включає визначення наявності поліморфних алелей А та G, який відрізняється тим, що одночасно виявляється наявність "дикої" та мутантної алелі за допомогою полімеразної ланцюгової реакції з парою алель-специфічних праймерів та парою специфічних проб, мічених флуоресцентними барвниками FAM і R6G з...

Спосіб визначення культур penicillium candidum та geotrichum candidum методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 101938

Опубліковано: 13.05.2013

Автори: Семенівська Олена Анатоліївна, Малова Валерія Всеволодівна, Жукова Ярослава Фрідріхівна, Вакуленко Микола Михайлович

МПК: C12Q 1/68, C12N 15/11

Мітки: полімеразної, реакції, ланцюгової, культур, candidum, визначення, penicillium, спосіб, geotrichum, методом

Формула / Реферат:

Спосіб визначення культур Penicillium candidum та Geotrichum candidum у м'яких сичужних сирах методом полімеразної ланцюгової реакції, який відрізняється тим, що для ідентифікації фрагмента ДНК-культур Penicillium candidum застосовують пару синтетичних олігонуклеотидних праймерів:прямий праймер gapdhF 5'-CGCCAATCTGCCGTAGGCCAT-3'та зворотній праймер gapdhR...

Спосіб детекції трансформаційної події кукурудзи mon810 методом мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 77769

Опубліковано: 25.02.2013

Автори: Банникова Марія Олександрівна, Марковський Олексій Вікторович, Моргун Богдан Володимирович, Федоренко Тетяна Валеріївна

МПК: C12N 15/32, C12N 15/31, C12N 15/82 ...

Мітки: мультиплексної, mon810, методом, трансформаційної, реакції, полімеразної, спосіб, ланцюгової, детекції, кукурудзи, події

Формула / Реферат:

Спосіб детекції трансформаційної події кукурудзи MON810 в генетично модифікованій рослині методом мультиплексної полімеразної ланцюгової реакції, для здійснення якого проводять денатурацію рослинної ДНК; цикли, кожен з яких включає денатурацію ДНК, ренатурацію рослинної ДНК з олігонуклеотидними праймерами, синтез фрагментів цільових генів; кінцевий синтез фрагментів цільових генів, який відрізняється тим, що для проведення мультиплексної...

Спосіб детекції трансформаційної події кукурудзи nk603 методом мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 77768

Опубліковано: 25.02.2013

Автори: Банникова Марія Олександрівна, Федоренко Тетяна Валеріївна, Моргун Богдан Володимирович, Марковський Олексій Вікторович

МПК: C12P 19/34, C12N 15/31, C12N 15/82 ...

Мітки: трансформаційної, ланцюгової, детекції, спосіб, мультиплексної, кукурудзи, методом, події, nk603, полімеразної, реакції

Формула / Реферат:

Спосіб детекції трансформаційної події кукурудзи NK603 в генетично модифікованій рослині методом мультиплексної полімеразної ланцюгової реакції, для здійснення якого проводять денатурацію рослинної ДНК; цикли, кожен з яких включає денатурацію ДНК, ренатурацію рослинної ДНК з олігонуклеотидними праймерами, синтез фрагментів цільових генів; кінцевий синтез фрагментів цільових генів, який відрізняється тим, що для проведення мультиплексної...

Спосіб діагностики мvx методом мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 68996

Опубліковано: 25.04.2012

Автори: Антіпов Ігор Олександрович, Мельничук Максим Дмитрович, Іванова Тетяна Василівна

МПК: C12Q 1/68

Мітки: реакції, спосіб, методом, мультиплексної, діагностики, ланцюгової, полімеразної

Формула / Реферат:

Спосіб діагностики MVX методом мультиплексної полімеразної ланцюгової реакції, що включає відбір зразків, екстракцію длРНК із зразків, реакцію зворотної транскрипції, проведення полімеразної ланцюгової реакції (ПЛР), візуалізацію та аналіз результатів, який відрізняється тим, що для проведення ПЛР використовується дві пари праймерів, одна пара АВ 18s_fl TAGGATAGAGGCCTACCA і АВ 18s_rl TTCGCAGTAGTCGGTCTTGA специфічна до послідовності до 18S...

Спосіб використання мультиплексної полімеразної ланцюгової реакції для визначення пародонтопатогенної флори

Завантаження...

Номер патенту: 65337

Опубліковано: 12.12.2011

Автори: Боброва Нелля Олександрівна, Кайдашев Ігор Петрович, Весніна Людмила Едуардівна, Ізмайлова Ольга Ваталіївна, Шликова Оксана Анатоліївна

МПК: G01N 33/00

Мітки: використання, флори, ланцюгової, спосіб, пародонтопатогенної, реакції, визначення, мультиплексної, полімеразної

Формула / Реферат:

Спосіб використання мультиплексної полімеразної ланцюгової реакції для визначення наявності та співвідношення окремих мікроорганізмів, який відрізняється тим, що визначення проводять в порожнині рота, як мікроорганізми визначають - Lactobacillus spp./BK, Enterobacterium spp., Streptococcus spp., Gardnerella vaginalis/Prevotella bivia/Porphyromonas spp., Eubacterium spp., Mycoplasma genitalium+hominis, Candida spp.., а полімеразну ланцюгову...

Спосіб екстракції днк з матеріалу рослинного походження для генетичного аналізу за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 62611

Опубліковано: 12.09.2011

Автори: Солодянкін Олексій Сергійович, Герілович Антон Павлович, Стегній Борис Тимофійович, Сапко Світлана Анатоліївна

МПК: C12N 7/00

Мітки: генетичного, аналізу, екстракції, рослинного, спосіб, днк, допомогою, полімеразної, реакції, походження, ланцюгової, матеріалу

Формула / Реферат:

Спосіб екстракції ДНК з матеріалу рослинного походження для генетичного аналізу за допомогою полімеразної ланцюгової реакції, що включає лізис клітин бромистим цетилтриметиламонієм, сорбцію ДНК на діоксид кремнію, дворазове відмивання діоксиду кремнію 70 % етанолом, який відрізняється тим, що на кінцевій стадії відмивання використовують хлороформ з ізопропанолом.

Спосіб екстракції днк з крові хребетних для генетичного аналізу за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 62610

Опубліковано: 12.09.2011

Автори: Герілович Антон Павлович, Солодянкін Олексій Сергійович, Стегній Борис Тимофійович

МПК: C12N 7/00

Мітки: реакції, хребетних, екстракції, спосіб, днк, генетичного, крові, полімеразної, допомогою, ланцюгової, аналізу

Формула / Реферат:

Спосіб екстракції ДНК з крові хребетних для генетичного аналізу за допомогою полімеразної ланцюгової реакції, що включає лізис еритроцитів, сорбцію ДНК на діоксид кремнію, центрифугування та відмивання ДНК, який відрізняється тим, що на етапі селективного лізису еритроцитів використовують розчин хлориду амонію, калію гідрокарбонату.

Спосіб екстракції днк з тканин тваринного походження для генетичного аналізу за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 62609

Опубліковано: 12.09.2011

Автори: Солодянкін Олексій Сергійович, Герілович Антон Павлович, Стегній Борис Тимофійович, Сапко Світлана Анатоліївна

МПК: C12N 7/00

Мітки: аналізу, ланцюгової, полімеразної, екстракції, тваринного, походження, тканин, днк, реакції, спосіб, генетичного, допомогою

Формула / Реферат:

Спосіб екстракції ДНК з тканин тваринного походження для генетичного аналізу за допомогою полімеразної ланцюгової реакції, що включає ферментативний метод дезінтеграції тканин, який відрізняється тим, що для протеолітичної обробки використовують розчин трипсину, фільтрують клітини від грубих механічних домішок, лізують клітини гуанідином тіоціанатом, сорбцію ДНК проводять на діоксиді кремнію та дворазово відмивають діоксид кремнію 70 %...

Спосіб визначення трансгенної лінії ga21 кукурудзи за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 61602

Опубліковано: 25.07.2011

Автори: Кучук Микола Вікторович, Борисова Вікторія Вікторівна, Моргун Богдан Володимирович, Банникова Марія Олександрівна, Сатарова Тетяна Миколаївна

МПК: C12N 15/00

Мітки: визначення, полімеразної, спосіб, реакції, ланцюгової, кукурудзи, трансгенної, допомогою, лінії

Формула / Реферат:

Спосіб детекції мутантного гена 5-енолпірувіл шікімат-3-фосфат синтази кукурудзи (Zea mays L.) у генетично модифікованій рослині методом полімеразної ланцюгової реакції, для здійснення якої проводять термальну денатурацію рослинної ДНК; циклічну ампліфікацію, де кожен цикл включає денатурацію ДНК, ренатурацію рослинної ДНК з олігонуклеотидними праймерами, синтез фрагментів цільових генів; синтез фрагментів цільових генів, для проведення...

Спосіб виявлення плазмід pхо1 та pхо2 в складі бактерій bacillus anthracis за допомогою мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 55775

Опубліковано: 27.12.2010

Автори: Дерябін Олег Миколайович, Скрипнік Артем Валерійович, Дерябіна Олена Григорівна, Бєднов Максим Олександрович

МПК: A61K 39/27

Мітки: bacillus, pхо1, складі, anthracis, виявлення, спосіб, мультиплексної, полімеразної, плазмід, ланцюгової, бактерій, допомогою, pхо2, реакції

Формула / Реферат:

Спосіб виявлення ДНК плазмід рХО1 та рХО2 в складі бактерій Bacillus anthracis, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) за допомогою мультиплексного варіанту полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно синтезовані олігонуклеотидні праймери з наступною послідовністю нуклеотидів:для плазміди рХО1 (ген протективного...

Спосіб виявлення рнк вірусу геморагічної септицемії форелі за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 54336

Опубліковано: 10.11.2010

Автори: Гайдей Ольга Сергіївна, Бабкін Михайло Валерійович, Дерябін Олег Миколайович, Ушкалов Валерій Олександрович, Головко Анатолій Миколайович

МПК: A61K 39/39

Мітки: ланцюгової, рнк, полімеразної, зворотно-транскриптазної, форелі, допомогою, реакції, геморагічної, виявлення, септицемії, вірусу, спосіб

Формула / Реферат:

Спосіб виявлення РНК вірусу геморагічної септицемії форелі за допомогою полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (РНК) за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції (ЗТ-ПЛР), який відрізняється тим, що для проведення ЗТ-ПЛР використовують штучно синтезовані вироджені олігонуклеотидні праймери з наступною послідовністю...

Спосіб ідентифікації giardia intestinalis у популяції собак за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 53593

Опубліковано: 11.10.2010

Автори: Булавіна Вікторія Сергіївна, Приходько Юрій Олександрович, Пономаренко Володимир Якович, Кульшин Володимир Євгенович

МПК: C12Q 1/68

Мітки: ідентифікації, реакції, полімеразної, собак, спосіб, популяції, ланцюгової, допомогою, giardia, intestinalis

Формула / Реферат:

Спосіб ідентифікації Giardia intestinalis у популяції собак за допомогою полімеразної ланцюгової реакції, що включає проведення ПЛР, пробопідготовку, ампліфікацію, детекцію ампліфікаційної ДНК, який відрізняється тим, що використовують ДНК ген бетагіардину, який складається з таких послідовностей пар праймерів:5'-CAGCGCGTCAGCAGGTTCCA5' -GGGCCTCCTTCCTGAGGGCT.

Спосіб виявлення рнк вірусу сказу за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 52924

Опубліковано: 10.09.2010

Автори: Дерябін Олег Миколайович, Ушкалов Валерій Олександрович, Головко Максим Анатолійович, Бабкін Михайло Валерійович

МПК: A61K 39/205

Мітки: полімеразної, рнк, спосіб, зворотно-транскриптазної, ланцюгової, допомогою, реакції, сказу, вірусу, виявлення

Формула / Реферат:

Спосіб виявлення РНК вірусу сказу за допомогою полімеразної ланцюгової реакції (ПЛР), що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (РНК) за допомогою "гніздового" варіанта зворотно-транскриптазної полімеразної ланцюгової реакції (ЗТ-ПЛР), який відрізняється тим, що для проведення ПЛР на першому етапі використовують штучно синтезовані олігонуклеотидні праймери з наступною послідовністю...

Спосіб детекції рекомбінантного гена ацил-ліпідної десатурази, злитої з термостабільною ліхеназою, в генетично модифікованій рослині методом мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 51842

Опубліковано: 10.08.2010

Автори: Сіндаровська Яна Рудольфівна, Бєрдічєвєц Іріна Ніколаєвна, Шелудько Юрій Всеволодович, Голдєнкова-Павлова Іріна Васільєвна, Шімшілашвілі Хрістіна Романовна, Герасименко Ірина Михайлівна

МПК: C12Q 1/25, C12N 15/00, C12Q 1/68 ...

Мітки: модифікований, мультиплексної, генетично, спосіб, реакції, детекції, полімеразної, гена, термостабільною, десатурази, рослини, злито, рекомбінантного, ланцюгової, ацил-ліпідної, методом, ліхеназою

Формула / Реферат:

Спосіб детекції рекомбінантного гена ацил-ліпідної десатурази, злитої з термостабільною ліхеназою, в генетично модифікованій рослині методом мультиплексної полімеразної ланцюгової реакції, для здійснення якого проводять денатурацію рослинної ДНК; цикли, кожен з яких включає денатурацію ДНК, ренатурацію рослинної ДНК з олігонуклеотидними праймерами, синтез фрагментів цільових генів, який відрізняється тим, що для проведення мультиплексної...