Патенти з міткою «ланцюгової»

Спосіб диференційної діагностики африканської та класичної чуми свиней методом дуплексної полімеразної ланцюгової реакції у режимі реального часу

Завантаження...

Номер патенту: 122578

Опубліковано: 10.01.2018

Автори: Спиридонов Владислав Генадійович, Ничик Сергій Анатолійович, Іщенко Людмила Мар'янівна, Музикіна Лариса Миколаївна, Мельничук Сергій Дмитрович, Мандигра Світлана Станіславівна, Галка Ігор Васильович, Коваленко Ганна Андріївна, Ситюк Микола Петрович

МПК: G01N 33/48

Мітки: свиней, африканської, режимі, чуми, ланцюгової, полімеразної, діагностики, реакції, методом, спосіб, часу, реального, дуплексної, класичної, диференційної

Формула / Реферат:

Спосіб диференційної діагностики африканської та класичної чуми свиней (АЧС та КЧС) методом дуплексної полімеразної ланцюгової реакції у режимі реального часу, що включає ідентифікацію цільових ділянок гена B646L вірусу АЧС та 5' UTR вірусу КЧС, який відрізняється тим, що ампліфікація проводиться одночасно в одній пробірці з використанням двох пар специфічних праймерів: 1) для АЧС - ASF F (5' CTG СТС ATG GTA ТСА АТС ТТА TCG А 3') та ASF R...

Спосіб полімеразної ланцюгової реакції у режимі реального часу для діагностики африканської чуми свиней

Завантаження...

Номер патенту: 116390

Опубліковано: 25.05.2017

Автори: Ничик Сергій Анатолійович, Ситюк Микола Петрович, Галка Ігор Васильович, Спиридонов Владислав Геннадієвич

МПК: G01N 33/535, A61K 39/187

Мітки: полімеразної, свиней, чуми, спосіб, діагностики, часу, ланцюгової, африканської, реакції, режимі, реального

Формула / Реферат:

Спосіб полімеразної ланцюгової реакції у режимі реального часу для діагностики африканської чуми свиней, що призначений для виявлення в патологічному матеріалі (фрагменти лімфоїдних, паранхіматозних органів, тканин) ДНК вірусу АЧС шляхом приготування суспензії з патологічного субстрату, виділенням нуклеїнової кислоти та її ампліфікації, який відрізняється тим, що детекцію ДНК вірусу АЧС здійснюють за специфічною ділянкою гена, що кодує...

Спосіб визначення культур lactobacillus casei, lactobacillus paracasei та lactobacillus paracasei subsp. paracasei за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 114260

Опубліковано: 10.05.2017

Автори: Петров Пилип Ігорович, Жукова Ярослава Фрідріхівна, Науменко Оксана Василівна, Вакуленко Микола Михайлович, Мудрак Тетяна Петрівна

МПК: C12Q 1/68, C12N 15/11, C12Q 1/04 ...

Мітки: casei, праймерів, paracasei, визначення, олігонуклеотидних, культур, методом, допомогою, реакції, subsp, пари, спосіб, lactobacillus, специфічних, полімеразної, ланцюгової

Формула / Реферат:

Спосіб визначення культур Lactobacillus casei, Lactobacillus paracasei та Lactobacillus paracasei subsp. paracasei за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції у заквашувальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культур Lactobacillus casei,...

Спосіб ідентифікації шиготоксинутворюючих генів (stx1/stx2) escherichia coli методом полімеразної ланцюгової реакції в реальному часі

Завантаження...

Номер патенту: 115879

Опубліковано: 25.04.2017

Автори: Іщенко Людмила Мар'янівна, Виговська Лілія Миколаївна, Стародуб Микола Федорович, Ушкалов Валерій Олександрович, Спиридонов Владислав Генадійович, Мазур Тетяна Василівна, Новгородова Олександра Юріївна, Мачуський Олександр Вікторович

МПК: C12R 1/19, G01N 30/04, G01N 29/24 ...

Мітки: полімеразної, шиготоксинутворюючих, спосіб, ланцюгової, методом, escherichia, часі, генів, реакції, реальному, ідентифікації

Формула / Реферат:

Спосіб ідентифікації шиготоксиноутворюючих генів (stxl і stx2) Escherichia coli методом полімеразної ланцюгової реакції в реальному часі, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) ентерогеморагічних ешерихій за допомогою ферментативної реакції з шістьма штучно синтезованими олігонуклеотидними ланцюгами, які багаторазово копіюють специфічні ділянки ДНК інфекційного агента при певних...

Спосіб якісного та кількісного визначення видового складу багатокомпонентних бактеріальних препаратів за допомогою специфічних праймерів методом полімеразної ланцюгової реакції реального часу

Завантаження...

Номер патенту: 115774

Опубліковано: 25.04.2017

Автори: Шевченко Любов Миколаївна, Коробка Вадим Леонідович, Янковський Дмитро Станіславович, Кітам Володимир Олегович, Шевченко Тетяна Вікторівна, Літовченко Олександр Вікторович, Димент Галина Семенівна

МПК: C12R 1/01, C12N 1/20

Мітки: реакції, реального, видового, якісного, часу, спосіб, кількісного, полімеразної, методом, праймерів, бактеріальних, складу, ланцюгової, препаратів, визначення, багатокомпонентних, специфічних, допомогою

Формула / Реферат:

Спосіб якісного та кількісного визначення видового складу багатокомпонентного бактеріального препарату, щомістить представників родів Bifidobacterium, Lactobacillus, Propionibacterium, Lactococcus, Streptococcus та Acetobacter, за допомогою специфічних праймерів методом полімеразної ланцюгової реакції в режимі реального часу, який відрізняється тим, що визначають склад бактеріального препарату на рівні видів Lactobacillus acidophilus,...

Спосіб індикації salmonella spp. методом полімеразної ланцюгової реакції в реальному часі

Завантаження...

Номер патенту: 115440

Опубліковано: 10.04.2017

Автори: Спиридонов Владислав Генадійович, Стародуб Микола Федорович, Виговська Лілія Миколаївна, Новгородова Олександра Юріївна, Іщенко Людмила Мар'янівна, Мачуський Олександр Вікторович, Ушкалов Валерій Олександрович, Мазур Тетяна Василівна

МПК: G01N 29/24, C12R 1/42, C12Q 1/12 ...

Мітки: salmonella, спосіб, індикації, реальному, реакції, часі, ланцюгової, полімеразної, методом

Формула / Реферат:

Спосіб індикації Salmonella spp. методом полімеразної ланцюгової реакції в реальному часі, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) мікроорганізмів роду Salmonella за допомогою ферментативної реакції і трьох штучно синтезованих олігонуклеотидних ланцюгів, які дозволяють багаторазово копіювати специфічні ділянки ДНК сальмонел при певних температурних і часових параметрах та кількості...

Спосіб детекції патогенних для людини бабезій за допомогою мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 115268

Опубліковано: 10.04.2017

Автори: Чигиринська Ніла Анатоліївна, Похил Сергій Іванови, Лець Вікторія Василівна, Білозоров Олексій Павлович, Тимченко Олена Миколаївна, Круглова Тетяна Анатоліївна, Казмірчук Віктор Володимирович, Костиря Ірина Анатоліївна, Торянік Інна Іванівна

МПК: G01N 33/50, C12Q 1/68, A61K 35/68 ...

Мітки: патогенних, бабезій, мультиплексної, ланцюгової, полімеразної, детекції, допомогою, людини, реакції, спосіб

Формула / Реферат:

Спосіб детекції патогенних для людини бабезій за допомогою мультиплексної полімеразної ланцюгової реакції (ПЛР), що включає виявлення специфічних ампліконів (копій фрагментів гену 18S rRNA Babesia microti, В. divergens + В. venatorum), попередньо одержаних за допомогою мультиплексної ПЛР, який відрізняється тим, що для відтворення реакції використовують праймери BabUnF, BabMicR і BabDivR із такою послідовністю нуклеотидів:BabUnF 5' -...

Спосіб виявлення рнк вірусу хвороби тешена свиней методом полімеразної ланцюгової реакції в режимі реального часу

Завантаження...

Номер патенту: 114872

Опубліковано: 27.03.2017

Автори: Музикіна Лариса Миколаївна, Ситюк Микола Петрович, Спиридонов Владислав Генадійович, Іщенко Людмила Мар'янівна, Галка Ігор Васильович

МПК: G01N 33/569

Мітки: свиней, полімеразної, методом, часу, вірусу, режимі, спосіб, реакції, виявлення, тешена, ланцюгової, реального, хвороби, рнк

Формула / Реферат:

Спосіб виявлення РНК вірусу хвороби Тешена свиней методом полімеразної ланцюгової реакції в режимі реального часу (ПЛР-РЧ), що включає виділення в досліджуваній пробі РНК вірусу, отримання кДНК, який відрізняється тим, що ампліфікація специфічної ділянки кДНК здійснюється з використанням специфічних олігонуклеотидних праймерів з наступними послідовностями: PTV-1-F - 5'TCTGTTGCTGTGAGGGTAATG, PTV-1-R - 5'AGTCTTGTGCCTGTTCTATGG, а також...

Спосіб якісного та кількісного визначення вмісту біфідобактерій за допомогою специфічних праймерів методом полімеразної ланцюгової реакції реального часу

Завантаження...

Номер патенту: 112731

Опубліковано: 26.12.2016

Автори: Шевченко Тетяна Вікторівна, Янковський Дмитро Станіславович, Кітам Володимир Олегович, Коробка Вадим Леонідович, Літовченко Олександр Вікторович, Димент Галина Семенівна, Шевченко Любов Миколаївна

МПК: C12N 15/11, C12Q 1/68

Мітки: спосіб, кількісного, полімеразної, ланцюгової, методом, допомогою, реального, праймерів, визначення, якісного, реакції, біфідобактерій, специфічних, часу, вмісту

Формула / Реферат:

Спосіб якісного та кількісного визначення вмісту біфідобактерій Bifidobacterium longum subsp. longum за допомогою специфічних праймерів методом полімеразної ланцюгової реакції реального часу, який відрізняється тим, що використовують праймери В. lonF 5'-TTTCTATTGAACAGACACAGGTTTGCCC-3' та В. lonR 5'-AAACTGATTTGCCGATTTTGCC-3', які дозволяють ампліфікувати ділянку CRISPR довжиною 268 пар нуклеотидів (1807…2074) В. longum subsp. longum, яка...

Спосіб визначення культур lactobacillus delbrueckii subsp. bulgaricus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 112951

Опубліковано: 10.11.2016

Автори: Жукова Ярослава Фрідріхівна, Науменко Оксана Василівна, Семенівська Олена Анатоліївна, Вакуленко Микола Михайлович

МПК: C12N 15/11, C12Q 1/04, C12Q 1/68 ...

Мітки: методом, праймерів, subsp, олігонуклеотидних, допомогою, полімеразної, delbrueckii, lactobacillus, спосіб, пари, культур, визначення, ланцюгової, реакції, специфічних, bulgaricus

Формула / Реферат:

Спосіб визначення культур Lactobacillus delbrueckii subsp. bulgaricus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культур Lactobacillus delbrueckii subsp. bulgaricus використовують пари олігонуклеотидних...

Спосіб виявлення генетично модифікованої сої методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 111914

Опубліковано: 24.06.2016

Автори: Семенівська Олена Анатоліївна, Вакуленко Микола Михайлович, Жукова Ярослава Фрідріхівна

МПК: C12N 15/11, C12Q 1/04, C12Q 1/68 ...

Мітки: виявлення, модифікованої, методом, сої, реакції, спосіб, генетично, ланцюгової, полімеразної

Формула / Реферат:

Спосіб виявлення генетично модифікованої сої у сировині та харчових продуктах методом полімеразної ланцюгової реакції, при якому застосовують пари праймерів, специфічних до маркерів: видоспецифічного гена Lectin сої Glycine max, який кодує білок лектин; гена CP4-EPSPS, з Agrobacterium tumefaciens, який кодує 5-енолпірувілшикімат-3-фосфатсинтазу; трансформаційної події GTS 40-3-2; промотору 35S з...

Спосіб визначення культур streptococcus thermophilus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 111130

Опубліковано: 25.03.2016

Автори: Мудрак Тетяна Петрівна, Науменко Оксана Василівна, Жукова Ярослава Фрідріхівна, Вакуленко Микола Михайлович, Чуманська Ганна Сергіївна

МПК: C12Q 1/04, C12Q 1/68, C12N 15/11 ...

Мітки: олігонуклеотидних, thermophilus, методом, спосіб, реакції, специфічних, культур, визначення, пари, допомогою, streptococcus, праймерів, полімеразної, ланцюгової

Формула / Реферат:

Спосіб визначення культур Streptococcus thermophilus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культур Streptococcus thermophilus використовують пари олігонуклеотидних праймерів до гена pbp2b:прямий праймер Stt F 5'-CAGCCGAAACCTATGCAACA-3' 20 bр...

Спосіб ідентифікації dipylidium caninum у популяції собак за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 103721

Опубліковано: 25.12.2015

Автори: Кульшин Володимир Євгенович, Лаптій Олена Петрівна, Приходько Юрій Олександрович, Приходько Олена Юріївна, Пономаренко Володимир Якович

МПК: C12Q 1/68, C12N 15/10

Мітки: популяції, допомогою, реакції, caninum, собак, полімеразної, ланцюгової, спосіб, dipylidium, ідентифікації

Формула / Реферат:

Спосіб ідентифікації Dipylidium caninum у популяції собак за допомогою полімеразної ланцюгової реакції, що включає проведення ПЛР, пробопідготовку, ампліфікацію, детекцію ампліфікаційної ДНК, який відрізняється тим, що використовують ДНК ген 12S рРНК, який складається з таких послідовностей пар праймерів:5’ - CAGCAAGTGAATCCGTTCAG-3’5’ – GCATCAAAACTCTAATAAGCAGCA-3’.

Спосіб виявлення днк yersinia enterocolitica за допомогою “напівгніздового” методу полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 103102

Опубліковано: 10.12.2015

Автори: Дерябін Олег Миколайович, Мачуський Олександр Вікторович, Ушкалов Артем Валерійович, Головко Анатолій Миколаєвич, Виговська Лілія Миколаївна, Поліщук Наталія Миколаївна

МПК: C12Q 1/00, G01N 33/00, A61K 31/00 ...

Мітки: yersinia, ланцюгової, виявлення, реакції, методу, днк, enterocolitica, спосіб, полімеразної, допомогою, напівгніздового

Формула / Реферат:

Спосіб виявлення ДНК бактерії YERSINIA ENTEROCOLITICA за допомогою полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) збудника за допомогою "напівгніздового" варіанта полімеразної ланцюгової реакції (ПЛР) - ферментативної реакції і трьох штучно синтезованих олігонуклеотидних праймерів, які дозволяють багаторазово копіювати специфічні ділянки ДНК...

Спосіб виявлення днк патогенних лептоспір роду leptospira, виду leptospira interrogans у клінічному і патологічному матеріалі та зразках води за допомогою полімеразної ланцюгової реакції у режимі реального часу

Завантаження...

Номер патенту: 101190

Опубліковано: 25.08.2015

Автори: Уховський Віталій Вікторович, Куликова Влада Вячеславівна, Кучерявенко Олександр Олександрович

МПК: C07K 14/20

Мітки: виявлення, роду, зразках, interrogans, клінічному, часу, патологічному, реального, днк, води, режимі, реакції, leptospira, допомогою, матеріали, полімеразної, лептоспір, виду, патогенних, ланцюгової, спосіб

Формула / Реферат:

Спосіб виявлення ДНК патогенних лептоспір роду Leptospira, виду Leptospira interrogans у клінічному і патологічному матеріалі та зразках води за допомогою полімеразної ланцюгової реакції у реальному часі (ПЛР-РЧ), який здійснюють за допомогою специфічних фрагментів нуклеїнових кислот (ДНК) та гібридизаційно-флуоресценції детекції продуктів ампліфікації у режимі реального часу, який відрізняється тим, що результат ампліфікації ДНК патогенних...

Спосіб виявлення днк бактерії coxiella burnetii збудника ку-лихоманки за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 100232

Опубліковано: 10.07.2015

Автори: Головко Анатолій Миколайович, Дерябін Олег Миколайович, Неволько Олег Михайлович, Марущак Людмила Василівна

МПК: C12Q 1/68

Мітки: днк, burnetii, виявлення, реакції, ланцюгової, coxiella, допомогою, спосіб, полімеразної, збудника, бактерії, ку-лихоманки

Формула / Реферат:

Спосіб виявлення ДНК бактерії Coxiella burnetii збудника Ку-лихоманки за допомогою полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (НК) гену соm l, який кодує висококонсервативний білок зовнішньої мембрани з М.м 27kDа збудника Ку-лихоманки за допомогою полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно...

Спосіб детекції dirofilaria imitis та dirofilaria repens у біологічних зразках за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 98472

Опубліковано: 27.04.2015

Автори: Михайличенко Олена Миколаївна, Приходько Олена Юріївна, Кульшин Володимир Євгенович, Приходько Юрій Олександрович, Тригубенко Вікторія Василівна, Решетило Олександр Іванович, Нікіфорова Ольга Василівна, Симоненко Василь Іванович

МПК: C12Q 1/68

Мітки: полімеразної, зразках, ланцюгової, детекції, imitis, реакції, біологічних, repens, dirofilaria, допомогою, спосіб

Формула / Реферат:

Спосіб детекції Dirofilaria imitis та Dirofilaria repens у біологічних зразках за допомогою полімеразної ланцюгової реакції, що включає проведення ПЛР, підготовку буферу, ампліфікацію, детекцію ампліфікаційної ДНК, який відрізняється тим, що використовують гени-мішені 12S рРНК, що містить такі послідовності пар праймерів:5 '-tttttgaccgggtttagtacc-3'5 '-tgtgccaataaaattcaccaa-3'Розмір продукту 152 п.н. для Dirofilaria...

Спосіб визначення днк культури lactococcus lactis subsp. lactis за допомогою специфічних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107897

Опубліковано: 25.02.2015

Автори: Вакуленко Микола Михайлович, Король Цвітана Олександрівна, Малова Валерія Всеволодівна, Жукова Ярослава Фрідріхівна, Науменко Оксана Василівна

МПК: C12N 15/00

Мітки: специфічних, культури, визначення, спосіб, lactis, ланцюгової, реакції, lactococcus, допомогою, полімеразної, методом, днк, subsp, праймерів

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. lactic за допомогою специфічних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культури Lactococcus lactis subsp. lactis, використовують пару олігонуклеотидних праймерів до гену асmА N-ацетилмурамідази:прямий...

Спосіб визначення днк культури lactococcus lactis subsp. cremoris методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107547

Опубліковано: 12.01.2015

Автори: Малова Валерія Всеволодівна, Вакуленко Микола Михайлович, Семенівська Олена Анатоліївна

МПК: C12N 15/09

Мітки: реакції, методом, спосіб, cremoris, культури, lactis, днк, полімеразної, ланцюгової, subsp, визначення, lactococcus

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. cremoris у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції,який відрізняється тим, що для визначення ДНК культур Lactococcus lactis subsp. cremoris, застосовують пару олігонуклеотидних праймерів до гену recN DNA repair protein:прямий праймер

Спосіб визначення днк культури lactococcus lactis subsp. lactis методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107546

Опубліковано: 12.01.2015

Автори: Семенівська Олена Анатоліївна, Малова Валерія Всеволодівна, Вакуленко Микола Михайлович

МПК: C12N 15/09

Мітки: lactococcus, полімеразної, реакції, методом, lactis, ланцюгової, днк, subsp, визначення, спосіб, культури

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. lactic у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції, який відрізняється тим, що для визначення ДНК культури Lactococcus lactis subsp. lactis застосовують пару олігонуклеотидних праймерів до гену recN DNA repair protein:прямий праймер recN F: 5'- CAGGCTGAAGAAATTGAAGC-3' 20 bp тазворотній праймер recN R: 5'-...

Спосіб виявлення рнк вірусу чуми м’ясоїдних за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 94267

Опубліковано: 10.11.2014

Автори: Карпуленко Максим Сергійович, Кацимон Вадим Васильович, Дерябін Олег Миколайович, Головко Оксана Анатольївна

МПК: G01N 33/569, C07K 14/08, C12N 15/00 ...

Мітки: вірусу, зворотно-транскриптазної, рнк, виявлення, допомогою, реакції, полімеразної, спосіб, чуми, м'ясоїдних, ланцюгової

Формула / Реферат:

Спосіб виявлення РНК вірусу чуми м'ясоїдних за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (РНК) за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції (ЗТ-ПЛР), який відрізняється тим, що для проведення ЗТ-ПЛР використовують розроблені, штучно синтезовані, олігонуклеотидні праймери з наступною послідовністю...

Спосіб визначення культури lactococcus lactis subsp. cremoris за допомогою специфічних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 105349

Опубліковано: 25.04.2014

Автори: Вакуленко Микола Михайлович, Король Цвітана Олександрівна, Жукова Ярослава Фрідріхівна, Науменко Оксана Василівна, Малова Валерія Всеволодівна

МПК: C12N 15/09

Мітки: ланцюгової, визначення, специфічних, культури, методом, праймерів, lactis, cremoris, полімеразної, допомогою, спосіб, subsp, lactococcus, реакції

Формула / Реферат:

Спосіб визначення культури Lactococcus lactis subsp. cremoris за допомогою специфічних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культури Lactococcus lactis subsp. сremoris використовують пару олігонуклеотидних праймерів до гену асmА N-ацетилмурамідази: прямий...

Спосіб визначення днк культур lactococcus lactis subsp. lactic та lactococcus lactis subsp. cremoris методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 105310

Опубліковано: 25.04.2014

Автори: Малова Валерія Всеволодівна, Вакуленко Микола Михайлович, Семенівська Олена Анатоліївна

МПК: C12N 15/09

Мітки: культур, lactis, subsp, cremoris, ланцюгової, lactococcus, спосіб, реакції, полімеразної, методом, визначення, lactic, днк

Формула / Реферат:

Спосіб визначення ДНК культур Lactococcus lactis subsp. lactic та Lactococcus lactis subsp. cremoris у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції, які відрізняються тим, що для визначення ДНК культур Lactococcus lactis subsp. lactis та Lactococcus lactis subsp. cremoris, застосовують пари олігонуклеотидних праймерів до гену recN...

Спосіб детекції трансформаційної події gt73 ріпаку методом мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 88203

Опубліковано: 11.03.2014

Автори: Моргун Богдан Володимирович, Степаненко Антон Ігорович, Степаненко Олена Василівна

МПК: C12N 15/00

Мітки: ланцюгової, події, мультиплексної, методом, полімеразної, реакції, детекції, трансформаційної, ріпаку, спосіб

Формула / Реферат:

Спосіб детекції трансформаційної події ріпаку GT73 в генетично модифікованій рослині методом мультиплексної полімеразної ланцюгової реакції, для здійснення якого проводять денатурацію рослинної ДНК; цикли, кожен з яких включає денатурацію ДНК, ренатурацію рослинної ДНК з олігонуклеотидними праймерами, синтез фрагментів цільових генів; синтез фрагментів цільових генів, який відрізняється тим, що для проведення мультиплексної полімеразної...

Спосіб диференційної діагностики ентеритів гусей з використанням дуплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 87312

Опубліковано: 10.02.2014

Автори: Терещенко Олександр Володимирович, Кулібаба Роман Олександрович, Білецька Ганна Василівна, Юрко Поліна Сергіївна

МПК: C12Q 1/70

Мітки: спосіб, ентеритів, диференційної, дуплексної, полімеразної, реакції, гусей, ланцюгової, використанням, діагностики

Формула / Реферат:

Спосіб диференційної діагностики ентеритів гусей різної вірусної етіології, що включає ідентифікацію фрагментів геномів збудників ентеритів гусей за допомогою полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що проводять дуплексну ПЛР в "одній пробірці", у результаті якої можливе одночасне визначення фрагментів геномів парвовірусу та поліомавірусу, що дозволяє розрізнити захворювання, симптомокомплекси яких...

Спосіб визначення однонуклеотидного поліморфізму g28197a>g гена еластину методом алель-специфічної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 85434

Опубліковано: 25.11.2013

Автори: Кайдашев Ігор Петрович, Воровський Олег Олегович, Весніна Людмила Едуардівна, Аветіков Давид Соломонович, Скрипник Володимир Михайлович, Шликова Оксана Анатоліївна

МПК: G01N 1/00, A61B 5/00

Мітки: полімеразної, поліморфізму, алель-специфічної, спосіб, еластину, визначення, g28197a>g, методом, ланцюгової, гена, реакції, однонуклеотидного

Формула / Реферат:

Спосіб визначення однонуклеотидного поліморфізму g28197A>G гена еластину методом алель-специфічної полімеразної ланцюгової реакції, що включає визначення наявності поліморфних алелей А та G, який відрізняється тим, що одночасно виявляється наявність "дикої" та мутантної алелі за допомогою полімеразної ланцюгової реакції з парою алель-специфічних праймерів та парою специфічних проб, мічених флуоресцентними барвниками FAM і R6G з...

Пристрій ланцюгової передачі для ланцюгових приводів гірничих комбайнів

Завантаження...

Номер патенту: 102599

Опубліковано: 25.07.2013

Автор: Крюгер Вольфганг

МПК: B65G 23/06, E21F 13/00, F16H 55/30 ...

Мітки: ланцюгової, передачі, приводів, пристрій, ланцюгових, гірничих, комбайнів

Формула / Реферат:

1. Пристрій ланцюгової передачі для ланцюгових приводів гірничих комбайнів, з валом (1) ланцюгової передачі, з ланцюговим колесом (20), що має щонайменше одну ланцюгову зірочку (21), з корпусами (4, 4') підшипників, розміщеними з обох сторін ланцюгового колеса (20), які служать для встановлення в них підшипників (5) для вала (2) ланцюгової передачі, і прикріпленими до агрегатної рами ланцюгового приводу, з ущільненням (42) пересувного кільця...

Спосіб визначення культур penicillium candidum та geotrichum candidum методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 101938

Опубліковано: 13.05.2013

Автори: Семенівська Олена Анатоліївна, Жукова Ярослава Фрідріхівна, Вакуленко Микола Михайлович, Малова Валерія Всеволодівна

МПК: C12N 15/11, C12Q 1/68

Мітки: penicillium, визначення, candidum, культур, geotrichum, реакції, ланцюгової, методом, полімеразної, спосіб

Формула / Реферат:

Спосіб визначення культур Penicillium candidum та Geotrichum candidum у м'яких сичужних сирах методом полімеразної ланцюгової реакції, який відрізняється тим, що для ідентифікації фрагмента ДНК-культур Penicillium candidum застосовують пару синтетичних олігонуклеотидних праймерів:прямий праймер gapdhF 5'-CGCCAATCTGCCGTAGGCCAT-3'та зворотній праймер gapdhR...

Спосіб детекції трансформаційної події кукурудзи mon810 методом мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 77769

Опубліковано: 25.02.2013

Автори: Моргун Богдан Володимирович, Банникова Марія Олександрівна, Федоренко Тетяна Валеріївна, Марковський Олексій Вікторович

МПК: C12N 15/82, C12N 15/32, C12N 15/31 ...

Мітки: детекції, mon810, мультиплексної, події, методом, ланцюгової, спосіб, кукурудзи, полімеразної, трансформаційної, реакції

Формула / Реферат:

Спосіб детекції трансформаційної події кукурудзи MON810 в генетично модифікованій рослині методом мультиплексної полімеразної ланцюгової реакції, для здійснення якого проводять денатурацію рослинної ДНК; цикли, кожен з яких включає денатурацію ДНК, ренатурацію рослинної ДНК з олігонуклеотидними праймерами, синтез фрагментів цільових генів; кінцевий синтез фрагментів цільових генів, який відрізняється тим, що для проведення мультиплексної...

Спосіб детекції трансформаційної події кукурудзи nk603 методом мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 77768

Опубліковано: 25.02.2013

Автори: Банникова Марія Олександрівна, Марковський Олексій Вікторович, Моргун Богдан Володимирович, Федоренко Тетяна Валеріївна

МПК: C12P 19/34, C12N 15/31, C12N 15/82 ...

Мітки: полімеразної, спосіб, трансформаційної, кукурудзи, nk603, мультиплексної, ланцюгової, реакції, детекції, події, методом

Формула / Реферат:

Спосіб детекції трансформаційної події кукурудзи NK603 в генетично модифікованій рослині методом мультиплексної полімеразної ланцюгової реакції, для здійснення якого проводять денатурацію рослинної ДНК; цикли, кожен з яких включає денатурацію ДНК, ренатурацію рослинної ДНК з олігонуклеотидними праймерами, синтез фрагментів цільових генів; кінцевий синтез фрагментів цільових генів, який відрізняється тим, що для проведення мультиплексної...

Ланцюг для ланцюгової завіси обертової печі

Завантаження...

Номер патенту: 77039

Опубліковано: 25.01.2013

Автори: Жирєнко Сєргєй Борісовіч, Зубачьов Алєксандр Сєргєєвіч

МПК: F28F 1/00

Мітки: печі, ланцюг, завіси, обертової, ланцюгової

Формула / Реферат:

Ланцюг для ланцюгової завіси обертової печі, що складається з поєднаних між собою ланок, де зовнішня поверхня кожної ланки виконана з оребренням, а внутрішня поверхня кожної ланки виконана криволінійною з радіусом, що дорівнює половині кроку ланцюга або радіусу криволінійної частини кроку ланцюга, який відрізняється тим, що оребрення виконане в поперечному перерізі тіла ланки у вигляді ламаної лінії, відрізки якої являють собою хорди...

Тест-система для визначення якісного та кількісного вмісту генетично модифікованих організмів (гмо) в харчових продуктах методом полімерної ланцюгової реакції в реальному часі (плр-рч)

Завантаження...

Номер патенту: 72083

Опубліковано: 10.08.2012

Автори: Северинов Дмитро Олександрович, Облап Руслан Васильович, Голубець Руслан Анатолійович, Малієнко Вадим Анатолійович, Новак Ніна Богданівна, Семенович Володимир Костянтинович, Ример Віктор Давидович

МПК: C12N 15/00

Мітки: якісного, реальному, генетично, часі, харчових, тест-система, полімерної, ланцюгової, модифікованих, плр-рч, реакції, організмів, гмо, методом, продуктах, кількісного, визначення, вмісту

Формула / Реферат:

Тест-система для визначення якісного та кількісного вмісту генетично модифікованих організмів (ГМО) в харчових продуктах методом полімеразної ланцюгової реакції в реальному часі (ПЛР-РЧ), яка містить набір реагентів для екстрагування ДНК, суміш для проведення полімеразної ланцюгової реакції, Taq-полімеразу, сертифіковані стандартні зразки ДНК трансгенних культур, яка відрізняється тим, що містить оригінальну панель олігонуклеотидних...

Спосіб діагностики мvx методом мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 68996

Опубліковано: 25.04.2012

Автори: Антіпов Ігор Олександрович, Іванова Тетяна Василівна, Мельничук Максим Дмитрович

МПК: C12Q 1/68

Мітки: реакції, діагностики, полімеразної, ланцюгової, мультиплексної, спосіб, методом

Формула / Реферат:

Спосіб діагностики MVX методом мультиплексної полімеразної ланцюгової реакції, що включає відбір зразків, екстракцію длРНК із зразків, реакцію зворотної транскрипції, проведення полімеразної ланцюгової реакції (ПЛР), візуалізацію та аналіз результатів, який відрізняється тим, що для проведення ПЛР використовується дві пари праймерів, одна пара АВ 18s_fl TAGGATAGAGGCCTACCA і АВ 18s_rl TTCGCAGTAGTCGGTCTTGA специфічна до послідовності до 18S...

Спосіб використання мультиплексної полімеразної ланцюгової реакції для визначення пародонтопатогенної флори

Завантаження...

Номер патенту: 65337

Опубліковано: 12.12.2011

Автори: Боброва Нелля Олександрівна, Кайдашев Ігор Петрович, Весніна Людмила Едуардівна, Шликова Оксана Анатоліївна, Ізмайлова Ольга Ваталіївна

МПК: G01N 33/00

Мітки: реакції, визначення, флори, полімеразної, спосіб, використання, мультиплексної, пародонтопатогенної, ланцюгової

Формула / Реферат:

Спосіб використання мультиплексної полімеразної ланцюгової реакції для визначення наявності та співвідношення окремих мікроорганізмів, який відрізняється тим, що визначення проводять в порожнині рота, як мікроорганізми визначають - Lactobacillus spp./BK, Enterobacterium spp., Streptococcus spp., Gardnerella vaginalis/Prevotella bivia/Porphyromonas spp., Eubacterium spp., Mycoplasma genitalium+hominis, Candida spp.., а полімеразну ланцюгову...

Спосіб екстракції днк з матеріалу рослинного походження для генетичного аналізу за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 62611

Опубліковано: 12.09.2011

Автори: Сапко Світлана Анатоліївна, Солодянкін Олексій Сергійович, Стегній Борис Тимофійович, Герілович Антон Павлович

МПК: C12N 7/00

Мітки: спосіб, аналізу, днк, генетичного, допомогою, матеріалу, екстракції, реакції, полімеразної, ланцюгової, походження, рослинного

Формула / Реферат:

Спосіб екстракції ДНК з матеріалу рослинного походження для генетичного аналізу за допомогою полімеразної ланцюгової реакції, що включає лізис клітин бромистим цетилтриметиламонієм, сорбцію ДНК на діоксид кремнію, дворазове відмивання діоксиду кремнію 70 % етанолом, який відрізняється тим, що на кінцевій стадії відмивання використовують хлороформ з ізопропанолом.

Спосіб екстракції днк з крові хребетних для генетичного аналізу за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 62610

Опубліковано: 12.09.2011

Автори: Герілович Антон Павлович, Солодянкін Олексій Сергійович, Стегній Борис Тимофійович

МПК: C12N 7/00

Мітки: допомогою, хребетних, полімеразної, днк, спосіб, екстракції, генетичного, крові, реакції, аналізу, ланцюгової

Формула / Реферат:

Спосіб екстракції ДНК з крові хребетних для генетичного аналізу за допомогою полімеразної ланцюгової реакції, що включає лізис еритроцитів, сорбцію ДНК на діоксид кремнію, центрифугування та відмивання ДНК, який відрізняється тим, що на етапі селективного лізису еритроцитів використовують розчин хлориду амонію, калію гідрокарбонату.

Спосіб екстракції днк з тканин тваринного походження для генетичного аналізу за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 62609

Опубліковано: 12.09.2011

Автори: Стегній Борис Тимофійович, Сапко Світлана Анатоліївна, Герілович Антон Павлович, Солодянкін Олексій Сергійович

МПК: C12N 7/00

Мітки: походження, реакції, аналізу, полімеразної, допомогою, днк, тканин, тваринного, екстракції, спосіб, генетичного, ланцюгової

Формула / Реферат:

Спосіб екстракції ДНК з тканин тваринного походження для генетичного аналізу за допомогою полімеразної ланцюгової реакції, що включає ферментативний метод дезінтеграції тканин, який відрізняється тим, що для протеолітичної обробки використовують розчин трипсину, фільтрують клітини від грубих механічних домішок, лізують клітини гуанідином тіоціанатом, сорбцію ДНК проводять на діоксиді кремнію та дворазово відмивають діоксид кремнію 70 %...

Спосіб визначення трансгенної лінії ga21 кукурудзи за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 61602

Опубліковано: 25.07.2011

Автори: Борисова Вікторія Вікторівна, Банникова Марія Олександрівна, Сатарова Тетяна Миколаївна, Моргун Богдан Володимирович, Кучук Микола Вікторович

МПК: C12N 15/00

Мітки: ланцюгової, допомогою, реакції, полімеразної, кукурудзи, спосіб, трансгенної, лінії, визначення

Формула / Реферат:

Спосіб детекції мутантного гена 5-енолпірувіл шікімат-3-фосфат синтази кукурудзи (Zea mays L.) у генетично модифікованій рослині методом полімеразної ланцюгової реакції, для здійснення якої проводять термальну денатурацію рослинної ДНК; циклічну ампліфікацію, де кожен цикл включає денатурацію ДНК, ренатурацію рослинної ДНК з олігонуклеотидними праймерами, синтез фрагментів цільових генів; синтез фрагментів цільових генів, для проведення...

Спосіб виявлення плазмід pхо1 та pхо2 в складі бактерій bacillus anthracis за допомогою мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 55775

Опубліковано: 27.12.2010

Автори: Дерябін Олег Миколайович, Скрипнік Артем Валерійович, Бєднов Максим Олександрович, Дерябіна Олена Григорівна

МПК: A61K 39/27

Мітки: pхо1, виявлення, мультиплексної, pхо2, bacillus, ланцюгової, допомогою, anthracis, бактерій, плазмід, полімеразної, реакції, спосіб, складі

Формула / Реферат:

Спосіб виявлення ДНК плазмід рХО1 та рХО2 в складі бактерій Bacillus anthracis, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) за допомогою мультиплексного варіанту полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно синтезовані олігонуклеотидні праймери з наступною послідовністю нуклеотидів:для плазміди рХО1 (ген протективного...

Спосіб виявлення рнк вірусу геморагічної септицемії форелі за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 54336

Опубліковано: 10.11.2010

Автори: Бабкін Михайло Валерійович, Ушкалов Валерій Олександрович, Дерябін Олег Миколайович, Гайдей Ольга Сергіївна, Головко Анатолій Миколайович

МПК: A61K 39/39

Мітки: рнк, полімеразної, реакції, спосіб, зворотно-транскриптазної, ланцюгової, виявлення, допомогою, септицемії, форелі, вірусу, геморагічної

Формула / Реферат:

Спосіб виявлення РНК вірусу геморагічної септицемії форелі за допомогою полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (РНК) за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції (ЗТ-ПЛР), який відрізняється тим, що для проведення ЗТ-ПЛР використовують штучно синтезовані вироджені олігонуклеотидні праймери з наступною послідовністю...