Патенти з міткою «ланцюгової»

Спосіб диференційної діагностики африканської та класичної чуми свиней методом дуплексної полімеразної ланцюгової реакції у режимі реального часу

Завантаження...

Номер патенту: 122578

Опубліковано: 10.01.2018

Автори: Ситюк Микола Петрович, Мельничук Сергій Дмитрович, Коваленко Ганна Андріївна, Мандигра Світлана Станіславівна, Ничик Сергій Анатолійович, Музикіна Лариса Миколаївна, Галка Ігор Васильович, Іщенко Людмила Мар'янівна, Спиридонов Владислав Генадійович

МПК: G01N 33/48

Мітки: дуплексної, часу, полімеразної, реакції, реального, ланцюгової, спосіб, африканської, методом, режимі, чуми, свиней, діагностики, диференційної, класичної

Формула / Реферат:

Спосіб диференційної діагностики африканської та класичної чуми свиней (АЧС та КЧС) методом дуплексної полімеразної ланцюгової реакції у режимі реального часу, що включає ідентифікацію цільових ділянок гена B646L вірусу АЧС та 5' UTR вірусу КЧС, який відрізняється тим, що ампліфікація проводиться одночасно в одній пробірці з використанням двох пар специфічних праймерів: 1) для АЧС - ASF F (5' CTG СТС ATG GTA ТСА АТС ТТА TCG А 3') та ASF R...

Спосіб полімеразної ланцюгової реакції у режимі реального часу для діагностики африканської чуми свиней

Завантаження...

Номер патенту: 116390

Опубліковано: 25.05.2017

Автори: Ситюк Микола Петрович, Спиридонов Владислав Геннадієвич, Галка Ігор Васильович, Ничик Сергій Анатолійович

МПК: A61K 39/187, G01N 33/535

Мітки: часу, спосіб, реального, режимі, чуми, африканської, свиней, полімеразної, діагностики, реакції, ланцюгової

Формула / Реферат:

Спосіб полімеразної ланцюгової реакції у режимі реального часу для діагностики африканської чуми свиней, що призначений для виявлення в патологічному матеріалі (фрагменти лімфоїдних, паранхіматозних органів, тканин) ДНК вірусу АЧС шляхом приготування суспензії з патологічного субстрату, виділенням нуклеїнової кислоти та її ампліфікації, який відрізняється тим, що детекцію ДНК вірусу АЧС здійснюють за специфічною ділянкою гена, що кодує...

Спосіб визначення культур lactobacillus casei, lactobacillus paracasei та lactobacillus paracasei subsp. paracasei за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 114260

Опубліковано: 10.05.2017

Автори: Вакуленко Микола Михайлович, Науменко Оксана Василівна, Жукова Ярослава Фрідріхівна, Петров Пилип Ігорович, Мудрак Тетяна Петрівна

МПК: C12N 15/11, C12Q 1/04, C12Q 1/68 ...

Мітки: методом, допомогою, олігонуклеотидних, спосіб, casei, реакції, ланцюгової, полімеразної, пари, subsp, paracasei, специфічних, культур, lactobacillus, визначення, праймерів

Формула / Реферат:

Спосіб визначення культур Lactobacillus casei, Lactobacillus paracasei та Lactobacillus paracasei subsp. paracasei за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції у заквашувальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культур Lactobacillus casei,...

Спосіб ідентифікації шиготоксинутворюючих генів (stx1/stx2) escherichia coli методом полімеразної ланцюгової реакції в реальному часі

Завантаження...

Номер патенту: 115879

Опубліковано: 25.04.2017

Автори: Ушкалов Валерій Олександрович, Новгородова Олександра Юріївна, Мазур Тетяна Василівна, Іщенко Людмила Мар'янівна, Стародуб Микола Федорович, Спиридонов Владислав Генадійович, Мачуський Олександр Вікторович, Виговська Лілія Миколаївна

МПК: G01N 29/24, C12R 1/19, G01N 30/04 ...

Мітки: ідентифікації, полімеразної, спосіб, часі, escherichia, реальному, генів, ланцюгової, реакції, методом, шиготоксинутворюючих

Формула / Реферат:

Спосіб ідентифікації шиготоксиноутворюючих генів (stxl і stx2) Escherichia coli методом полімеразної ланцюгової реакції в реальному часі, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) ентерогеморагічних ешерихій за допомогою ферментативної реакції з шістьма штучно синтезованими олігонуклеотидними ланцюгами, які багаторазово копіюють специфічні ділянки ДНК інфекційного агента при певних...

Спосіб якісного та кількісного визначення видового складу багатокомпонентних бактеріальних препаратів за допомогою специфічних праймерів методом полімеразної ланцюгової реакції реального часу

Завантаження...

Номер патенту: 115774

Опубліковано: 25.04.2017

Автори: Янковський Дмитро Станіславович, Димент Галина Семенівна, Шевченко Тетяна Вікторівна, Літовченко Олександр Вікторович, Коробка Вадим Леонідович, Кітам Володимир Олегович, Шевченко Любов Миколаївна

МПК: C12N 1/20, C12R 1/01

Мітки: бактеріальних, багатокомпонентних, методом, складу, визначення, часу, праймерів, полімеразної, допомогою, реального, ланцюгової, кількісного, реакції, якісного, специфічних, препаратів, видового, спосіб

Формула / Реферат:

Спосіб якісного та кількісного визначення видового складу багатокомпонентного бактеріального препарату, щомістить представників родів Bifidobacterium, Lactobacillus, Propionibacterium, Lactococcus, Streptococcus та Acetobacter, за допомогою специфічних праймерів методом полімеразної ланцюгової реакції в режимі реального часу, який відрізняється тим, що визначають склад бактеріального препарату на рівні видів Lactobacillus acidophilus,...

Спосіб індикації salmonella spp. методом полімеразної ланцюгової реакції в реальному часі

Завантаження...

Номер патенту: 115440

Опубліковано: 10.04.2017

Автори: Стародуб Микола Федорович, Мачуський Олександр Вікторович, Мазур Тетяна Василівна, Новгородова Олександра Юріївна, Спиридонов Владислав Генадійович, Ушкалов Валерій Олександрович, Виговська Лілія Миколаївна, Іщенко Людмила Мар'янівна

МПК: C12R 1/42, C12Q 1/12, G01N 29/24 ...

Мітки: індикації, salmonella, методом, полімеразної, ланцюгової, реакції, спосіб, часі, реальному

Формула / Реферат:

Спосіб індикації Salmonella spp. методом полімеразної ланцюгової реакції в реальному часі, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) мікроорганізмів роду Salmonella за допомогою ферментативної реакції і трьох штучно синтезованих олігонуклеотидних ланцюгів, які дозволяють багаторазово копіювати специфічні ділянки ДНК сальмонел при певних температурних і часових параметрах та кількості...

Спосіб детекції патогенних для людини бабезій за допомогою мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 115268

Опубліковано: 10.04.2017

Автори: Торянік Інна Іванівна, Круглова Тетяна Анатоліївна, Лець Вікторія Василівна, Костиря Ірина Анатоліївна, Казмірчук Віктор Володимирович, Білозоров Олексій Павлович, Чигиринська Ніла Анатоліївна, Похил Сергій Іванови, Тимченко Олена Миколаївна

МПК: C12Q 1/68, G01N 33/50, A61K 35/68 ...

Мітки: детекції, допомогою, людини, ланцюгової, бабезій, спосіб, патогенних, реакції, полімеразної, мультиплексної

Формула / Реферат:

Спосіб детекції патогенних для людини бабезій за допомогою мультиплексної полімеразної ланцюгової реакції (ПЛР), що включає виявлення специфічних ампліконів (копій фрагментів гену 18S rRNA Babesia microti, В. divergens + В. venatorum), попередньо одержаних за допомогою мультиплексної ПЛР, який відрізняється тим, що для відтворення реакції використовують праймери BabUnF, BabMicR і BabDivR із такою послідовністю нуклеотидів:BabUnF 5' -...

Спосіб виявлення рнк вірусу хвороби тешена свиней методом полімеразної ланцюгової реакції в режимі реального часу

Завантаження...

Номер патенту: 114872

Опубліковано: 27.03.2017

Автори: Ситюк Микола Петрович, Музикіна Лариса Миколаївна, Іщенко Людмила Мар'янівна, Галка Ігор Васильович, Спиридонов Владислав Генадійович

МПК: G01N 33/569

Мітки: полімеразної, спосіб, реального, виявлення, реакції, методом, свиней, режимі, рнк, хвороби, вірусу, часу, тешена, ланцюгової

Формула / Реферат:

Спосіб виявлення РНК вірусу хвороби Тешена свиней методом полімеразної ланцюгової реакції в режимі реального часу (ПЛР-РЧ), що включає виділення в досліджуваній пробі РНК вірусу, отримання кДНК, який відрізняється тим, що ампліфікація специфічної ділянки кДНК здійснюється з використанням специфічних олігонуклеотидних праймерів з наступними послідовностями: PTV-1-F - 5'TCTGTTGCTGTGAGGGTAATG, PTV-1-R - 5'AGTCTTGTGCCTGTTCTATGG, а також...

Спосіб якісного та кількісного визначення вмісту біфідобактерій за допомогою специфічних праймерів методом полімеразної ланцюгової реакції реального часу

Завантаження...

Номер патенту: 112731

Опубліковано: 26.12.2016

Автори: Літовченко Олександр Вікторович, Янковський Дмитро Станіславович, Кітам Володимир Олегович, Шевченко Любов Миколаївна, Димент Галина Семенівна, Коробка Вадим Леонідович, Шевченко Тетяна Вікторівна

МПК: C12N 15/11, C12Q 1/68

Мітки: реального, реакції, визначення, вмісту, часу, полімеразної, допомогою, спосіб, якісного, біфідобактерій, методом, кількісного, специфічних, праймерів, ланцюгової

Формула / Реферат:

Спосіб якісного та кількісного визначення вмісту біфідобактерій Bifidobacterium longum subsp. longum за допомогою специфічних праймерів методом полімеразної ланцюгової реакції реального часу, який відрізняється тим, що використовують праймери В. lonF 5'-TTTCTATTGAACAGACACAGGTTTGCCC-3' та В. lonR 5'-AAACTGATTTGCCGATTTTGCC-3', які дозволяють ампліфікувати ділянку CRISPR довжиною 268 пар нуклеотидів (1807…2074) В. longum subsp. longum, яка...

Спосіб визначення культур lactobacillus delbrueckii subsp. bulgaricus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 112951

Опубліковано: 10.11.2016

Автори: Жукова Ярослава Фрідріхівна, Вакуленко Микола Михайлович, Семенівська Олена Анатоліївна, Науменко Оксана Василівна

МПК: C12Q 1/68, C12N 15/11, C12Q 1/04 ...

Мітки: реакції, bulgaricus, subsp, олігонуклеотидних, lactobacillus, культур, delbrueckii, праймерів, спосіб, ланцюгової, полімеразної, специфічних, визначення, методом, допомогою, пари

Формула / Реферат:

Спосіб визначення культур Lactobacillus delbrueckii subsp. bulgaricus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культур Lactobacillus delbrueckii subsp. bulgaricus використовують пари олігонуклеотидних...

Спосіб виявлення генетично модифікованої сої методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 111914

Опубліковано: 24.06.2016

Автори: Жукова Ярослава Фрідріхівна, Вакуленко Микола Михайлович, Семенівська Олена Анатоліївна

МПК: C12N 15/11, C12Q 1/68, C12Q 1/04 ...

Мітки: генетично, модифікованої, полімеразної, методом, сої, спосіб, ланцюгової, реакції, виявлення

Формула / Реферат:

Спосіб виявлення генетично модифікованої сої у сировині та харчових продуктах методом полімеразної ланцюгової реакції, при якому застосовують пари праймерів, специфічних до маркерів: видоспецифічного гена Lectin сої Glycine max, який кодує білок лектин; гена CP4-EPSPS, з Agrobacterium tumefaciens, який кодує 5-енолпірувілшикімат-3-фосфатсинтазу; трансформаційної події GTS 40-3-2; промотору 35S з...

Спосіб визначення культур streptococcus thermophilus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 111130

Опубліковано: 25.03.2016

Автори: Жукова Ярослава Фрідріхівна, Науменко Оксана Василівна, Мудрак Тетяна Петрівна, Вакуленко Микола Михайлович, Чуманська Ганна Сергіївна

МПК: C12Q 1/04, C12N 15/11, C12Q 1/68 ...

Мітки: streptococcus, допомогою, культур, ланцюгової, олігонуклеотидних, спосіб, специфічних, методом, праймерів, полімеразної, визначення, пари, thermophilus, реакції

Формула / Реферат:

Спосіб визначення культур Streptococcus thermophilus за допомогою пари специфічних олігонуклеотидних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культур Streptococcus thermophilus використовують пари олігонуклеотидних праймерів до гена pbp2b:прямий праймер Stt F 5'-CAGCCGAAACCTATGCAACA-3' 20 bр...

Спосіб ідентифікації dipylidium caninum у популяції собак за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 103721

Опубліковано: 25.12.2015

Автори: Лаптій Олена Петрівна, Пономаренко Володимир Якович, Кульшин Володимир Євгенович, Приходько Олена Юріївна, Приходько Юрій Олександрович

МПК: C12N 15/10, C12Q 1/68

Мітки: собак, ланцюгової, dipylidium, ідентифікації, caninum, популяції, допомогою, реакції, полімеразної, спосіб

Формула / Реферат:

Спосіб ідентифікації Dipylidium caninum у популяції собак за допомогою полімеразної ланцюгової реакції, що включає проведення ПЛР, пробопідготовку, ампліфікацію, детекцію ампліфікаційної ДНК, який відрізняється тим, що використовують ДНК ген 12S рРНК, який складається з таких послідовностей пар праймерів:5’ - CAGCAAGTGAATCCGTTCAG-3’5’ – GCATCAAAACTCTAATAAGCAGCA-3’.

Спосіб виявлення днк yersinia enterocolitica за допомогою “напівгніздового” методу полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 103102

Опубліковано: 10.12.2015

Автори: Ушкалов Артем Валерійович, Виговська Лілія Миколаївна, Головко Анатолій Миколаєвич, Поліщук Наталія Миколаївна, Мачуський Олександр Вікторович, Дерябін Олег Миколайович

МПК: C12Q 1/00, G01N 33/00, A61K 31/00 ...

Мітки: спосіб, виявлення, yersinia, днк, напівгніздового, методу, enterocolitica, допомогою, ланцюгової, реакції, полімеразної

Формула / Реферат:

Спосіб виявлення ДНК бактерії YERSINIA ENTEROCOLITICA за допомогою полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) збудника за допомогою "напівгніздового" варіанта полімеразної ланцюгової реакції (ПЛР) - ферментативної реакції і трьох штучно синтезованих олігонуклеотидних праймерів, які дозволяють багаторазово копіювати специфічні ділянки ДНК...

Спосіб виявлення днк патогенних лептоспір роду leptospira, виду leptospira interrogans у клінічному і патологічному матеріалі та зразках води за допомогою полімеразної ланцюгової реакції у режимі реального часу

Завантаження...

Номер патенту: 101190

Опубліковано: 25.08.2015

Автори: Уховський Віталій Вікторович, Куликова Влада Вячеславівна, Кучерявенко Олександр Олександрович

МПК: C07K 14/20

Мітки: режимі, реального, часу, зразках, патогенних, ланцюгової, виду, матеріали, полімеразної, роду, днк, клінічному, спосіб, interrogans, leptospira, виявлення, допомогою, лептоспір, води, реакції, патологічному

Формула / Реферат:

Спосіб виявлення ДНК патогенних лептоспір роду Leptospira, виду Leptospira interrogans у клінічному і патологічному матеріалі та зразках води за допомогою полімеразної ланцюгової реакції у реальному часі (ПЛР-РЧ), який здійснюють за допомогою специфічних фрагментів нуклеїнових кислот (ДНК) та гібридизаційно-флуоресценції детекції продуктів ампліфікації у режимі реального часу, який відрізняється тим, що результат ампліфікації ДНК патогенних...

Спосіб виявлення днк бактерії coxiella burnetii збудника ку-лихоманки за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 100232

Опубліковано: 10.07.2015

Автори: Головко Анатолій Миколайович, Неволько Олег Михайлович, Марущак Людмила Василівна, Дерябін Олег Миколайович

МПК: C12Q 1/68

Мітки: спосіб, burnetii, бактерії, днк, полімеразної, допомогою, coxiella, ланцюгової, виявлення, ку-лихоманки, реакції, збудника

Формула / Реферат:

Спосіб виявлення ДНК бактерії Coxiella burnetii збудника Ку-лихоманки за допомогою полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (НК) гену соm l, який кодує висококонсервативний білок зовнішньої мембрани з М.м 27kDа збудника Ку-лихоманки за допомогою полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно...

Спосіб детекції dirofilaria imitis та dirofilaria repens у біологічних зразках за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 98472

Опубліковано: 27.04.2015

Автори: Приходько Олена Юріївна, Тригубенко Вікторія Василівна, Решетило Олександр Іванович, Симоненко Василь Іванович, Нікіфорова Ольга Василівна, Михайличенко Олена Миколаївна, Кульшин Володимир Євгенович, Приходько Юрій Олександрович

МПК: C12Q 1/68

Мітки: dirofilaria, реакції, детекції, repens, ланцюгової, спосіб, imitis, допомогою, біологічних, полімеразної, зразках

Формула / Реферат:

Спосіб детекції Dirofilaria imitis та Dirofilaria repens у біологічних зразках за допомогою полімеразної ланцюгової реакції, що включає проведення ПЛР, підготовку буферу, ампліфікацію, детекцію ампліфікаційної ДНК, який відрізняється тим, що використовують гени-мішені 12S рРНК, що містить такі послідовності пар праймерів:5 '-tttttgaccgggtttagtacc-3'5 '-tgtgccaataaaattcaccaa-3'Розмір продукту 152 п.н. для Dirofilaria...

Спосіб визначення днк культури lactococcus lactis subsp. lactis за допомогою специфічних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107897

Опубліковано: 25.02.2015

Автори: Малова Валерія Всеволодівна, Король Цвітана Олександрівна, Жукова Ярослава Фрідріхівна, Науменко Оксана Василівна, Вакуленко Микола Михайлович

МПК: C12N 15/00

Мітки: реакції, специфічних, праймерів, полімеразної, спосіб, визначення, ланцюгової, subsp, методом, допомогою, культури, lactis, днк, lactococcus

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. lactic за допомогою специфічних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культури Lactococcus lactis subsp. lactis, використовують пару олігонуклеотидних праймерів до гену асmА N-ацетилмурамідази:прямий...

Спосіб визначення днк культури lactococcus lactis subsp. cremoris методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107547

Опубліковано: 12.01.2015

Автори: Вакуленко Микола Михайлович, Семенівська Олена Анатоліївна, Малова Валерія Всеволодівна

МПК: C12N 15/09

Мітки: полімеразної, визначення, lactococcus, днк, реакції, lactis, спосіб, ланцюгової, методом, subsp, культури, cremoris

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. cremoris у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції,який відрізняється тим, що для визначення ДНК культур Lactococcus lactis subsp. cremoris, застосовують пару олігонуклеотидних праймерів до гену recN DNA repair protein:прямий праймер

Спосіб визначення днк культури lactococcus lactis subsp. lactis методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107546

Опубліковано: 12.01.2015

Автори: Семенівська Олена Анатоліївна, Малова Валерія Всеволодівна, Вакуленко Микола Михайлович

МПК: C12N 15/09

Мітки: спосіб, культури, реакції, subsp, lactococcus, визначення, lactis, ланцюгової, днк, полімеразної, методом

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. lactic у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції, який відрізняється тим, що для визначення ДНК культури Lactococcus lactis subsp. lactis застосовують пару олігонуклеотидних праймерів до гену recN DNA repair protein:прямий праймер recN F: 5'- CAGGCTGAAGAAATTGAAGC-3' 20 bp тазворотній праймер recN R: 5'-...

Спосіб виявлення рнк вірусу чуми м’ясоїдних за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 94267

Опубліковано: 10.11.2014

Автори: Дерябін Олег Миколайович, Карпуленко Максим Сергійович, Кацимон Вадим Васильович, Головко Оксана Анатольївна

МПК: C07K 14/08, C12N 15/00, G01N 33/569 ...

Мітки: ланцюгової, спосіб, вірусу, допомогою, зворотно-транскриптазної, полімеразної, чуми, рнк, м'ясоїдних, виявлення, реакції

Формула / Реферат:

Спосіб виявлення РНК вірусу чуми м'ясоїдних за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (РНК) за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції (ЗТ-ПЛР), який відрізняється тим, що для проведення ЗТ-ПЛР використовують розроблені, штучно синтезовані, олігонуклеотидні праймери з наступною послідовністю...

Спосіб визначення культури lactococcus lactis subsp. cremoris за допомогою специфічних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 105349

Опубліковано: 25.04.2014

Автори: Жукова Ярослава Фрідріхівна, Вакуленко Микола Михайлович, Малова Валерія Всеволодівна, Король Цвітана Олександрівна, Науменко Оксана Василівна

МПК: C12N 15/09

Мітки: культури, subsp, lactococcus, cremoris, методом, спосіб, визначення, праймерів, специфічних, lactis, допомогою, реакції, ланцюгової, полімеразної

Формула / Реферат:

Спосіб визначення культури Lactococcus lactis subsp. cremoris за допомогою специфічних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культури Lactococcus lactis subsp. сremoris використовують пару олігонуклеотидних праймерів до гену асmА N-ацетилмурамідази: прямий...

Спосіб визначення днк культур lactococcus lactis subsp. lactic та lactococcus lactis subsp. cremoris методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 105310

Опубліковано: 25.04.2014

Автори: Вакуленко Микола Михайлович, Семенівська Олена Анатоліївна, Малова Валерія Всеволодівна

МПК: C12N 15/09

Мітки: визначення, lactic, ланцюгової, методом, полімеразної, subsp, cremoris, реакції, культур, lactococcus, днк, спосіб, lactis

Формула / Реферат:

Спосіб визначення ДНК культур Lactococcus lactis subsp. lactic та Lactococcus lactis subsp. cremoris у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції, які відрізняються тим, що для визначення ДНК культур Lactococcus lactis subsp. lactis та Lactococcus lactis subsp. cremoris, застосовують пари олігонуклеотидних праймерів до гену recN...

Спосіб детекції трансформаційної події gt73 ріпаку методом мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 88203

Опубліковано: 11.03.2014

Автори: Степаненко Олена Василівна, Моргун Богдан Володимирович, Степаненко Антон Ігорович

МПК: C12N 15/00

Мітки: події, спосіб, мультиплексної, ріпаку, методом, трансформаційної, ланцюгової, детекції, реакції, полімеразної

Формула / Реферат:

Спосіб детекції трансформаційної події ріпаку GT73 в генетично модифікованій рослині методом мультиплексної полімеразної ланцюгової реакції, для здійснення якого проводять денатурацію рослинної ДНК; цикли, кожен з яких включає денатурацію ДНК, ренатурацію рослинної ДНК з олігонуклеотидними праймерами, синтез фрагментів цільових генів; синтез фрагментів цільових генів, який відрізняється тим, що для проведення мультиплексної полімеразної...

Спосіб диференційної діагностики ентеритів гусей з використанням дуплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 87312

Опубліковано: 10.02.2014

Автори: Кулібаба Роман Олександрович, Білецька Ганна Василівна, Терещенко Олександр Володимирович, Юрко Поліна Сергіївна

МПК: C12Q 1/70

Мітки: гусей, полімеразної, використанням, спосіб, ентеритів, дуплексної, диференційної, реакції, ланцюгової, діагностики

Формула / Реферат:

Спосіб диференційної діагностики ентеритів гусей різної вірусної етіології, що включає ідентифікацію фрагментів геномів збудників ентеритів гусей за допомогою полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що проводять дуплексну ПЛР в "одній пробірці", у результаті якої можливе одночасне визначення фрагментів геномів парвовірусу та поліомавірусу, що дозволяє розрізнити захворювання, симптомокомплекси яких...

Спосіб визначення однонуклеотидного поліморфізму g28197a>g гена еластину методом алель-специфічної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 85434

Опубліковано: 25.11.2013

Автори: Воровський Олег Олегович, Скрипник Володимир Михайлович, Аветіков Давид Соломонович, Весніна Людмила Едуардівна, Шликова Оксана Анатоліївна, Кайдашев Ігор Петрович

МПК: G01N 1/00, A61B 5/00

Мітки: визначення, ланцюгової, поліморфізму, реакції, спосіб, гена, полімеразної, g28197a>g, еластину, однонуклеотидного, методом, алель-специфічної

Формула / Реферат:

Спосіб визначення однонуклеотидного поліморфізму g28197A>G гена еластину методом алель-специфічної полімеразної ланцюгової реакції, що включає визначення наявності поліморфних алелей А та G, який відрізняється тим, що одночасно виявляється наявність "дикої" та мутантної алелі за допомогою полімеразної ланцюгової реакції з парою алель-специфічних праймерів та парою специфічних проб, мічених флуоресцентними барвниками FAM і R6G з...

Пристрій ланцюгової передачі для ланцюгових приводів гірничих комбайнів

Завантаження...

Номер патенту: 102599

Опубліковано: 25.07.2013

Автор: Крюгер Вольфганг

МПК: E21F 13/00, F16H 55/30, B65G 23/06 ...

Мітки: гірничих, ланцюгових, комбайнів, пристрій, передачі, приводів, ланцюгової

Формула / Реферат:

1. Пристрій ланцюгової передачі для ланцюгових приводів гірничих комбайнів, з валом (1) ланцюгової передачі, з ланцюговим колесом (20), що має щонайменше одну ланцюгову зірочку (21), з корпусами (4, 4') підшипників, розміщеними з обох сторін ланцюгового колеса (20), які служать для встановлення в них підшипників (5) для вала (2) ланцюгової передачі, і прикріпленими до агрегатної рами ланцюгового приводу, з ущільненням (42) пересувного кільця...

Спосіб визначення культур penicillium candidum та geotrichum candidum методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 101938

Опубліковано: 13.05.2013

Автори: Малова Валерія Всеволодівна, Семенівська Олена Анатоліївна, Вакуленко Микола Михайлович, Жукова Ярослава Фрідріхівна

МПК: C12Q 1/68, C12N 15/11

Мітки: спосіб, candidum, ланцюгової, визначення, полімеразної, geotrichum, penicillium, культур, реакції, методом

Формула / Реферат:

Спосіб визначення культур Penicillium candidum та Geotrichum candidum у м'яких сичужних сирах методом полімеразної ланцюгової реакції, який відрізняється тим, що для ідентифікації фрагмента ДНК-культур Penicillium candidum застосовують пару синтетичних олігонуклеотидних праймерів:прямий праймер gapdhF 5'-CGCCAATCTGCCGTAGGCCAT-3'та зворотній праймер gapdhR...

Спосіб детекції трансформаційної події кукурудзи mon810 методом мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 77769

Опубліковано: 25.02.2013

Автори: Федоренко Тетяна Валеріївна, Марковський Олексій Вікторович, Банникова Марія Олександрівна, Моргун Богдан Володимирович

МПК: C12N 15/31, C12N 15/82, C12N 15/32 ...

Мітки: мультиплексної, методом, події, mon810, полімеразної, реакції, ланцюгової, кукурудзи, трансформаційної, спосіб, детекції

Формула / Реферат:

Спосіб детекції трансформаційної події кукурудзи MON810 в генетично модифікованій рослині методом мультиплексної полімеразної ланцюгової реакції, для здійснення якого проводять денатурацію рослинної ДНК; цикли, кожен з яких включає денатурацію ДНК, ренатурацію рослинної ДНК з олігонуклеотидними праймерами, синтез фрагментів цільових генів; кінцевий синтез фрагментів цільових генів, який відрізняється тим, що для проведення мультиплексної...

Спосіб детекції трансформаційної події кукурудзи nk603 методом мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 77768

Опубліковано: 25.02.2013

Автори: Марковський Олексій Вікторович, Банникова Марія Олександрівна, Моргун Богдан Володимирович, Федоренко Тетяна Валеріївна

МПК: C12N 15/82, C12P 19/34, C12N 15/31 ...

Мітки: спосіб, реакції, трансформаційної, кукурудзи, ланцюгової, nk603, мультиплексної, методом, полімеразної, детекції, події

Формула / Реферат:

Спосіб детекції трансформаційної події кукурудзи NK603 в генетично модифікованій рослині методом мультиплексної полімеразної ланцюгової реакції, для здійснення якого проводять денатурацію рослинної ДНК; цикли, кожен з яких включає денатурацію ДНК, ренатурацію рослинної ДНК з олігонуклеотидними праймерами, синтез фрагментів цільових генів; кінцевий синтез фрагментів цільових генів, який відрізняється тим, що для проведення мультиплексної...

Ланцюг для ланцюгової завіси обертової печі

Завантаження...

Номер патенту: 77039

Опубліковано: 25.01.2013

Автори: Жирєнко Сєргєй Борісовіч, Зубачьов Алєксандр Сєргєєвіч

МПК: F28F 1/00

Мітки: ланцюгової, завіси, печі, ланцюг, обертової

Формула / Реферат:

Ланцюг для ланцюгової завіси обертової печі, що складається з поєднаних між собою ланок, де зовнішня поверхня кожної ланки виконана з оребренням, а внутрішня поверхня кожної ланки виконана криволінійною з радіусом, що дорівнює половині кроку ланцюга або радіусу криволінійної частини кроку ланцюга, який відрізняється тим, що оребрення виконане в поперечному перерізі тіла ланки у вигляді ламаної лінії, відрізки якої являють собою хорди...

Тест-система для визначення якісного та кількісного вмісту генетично модифікованих організмів (гмо) в харчових продуктах методом полімерної ланцюгової реакції в реальному часі (плр-рч)

Завантаження...

Номер патенту: 72083

Опубліковано: 10.08.2012

Автори: Северинов Дмитро Олександрович, Ример Віктор Давидович, Новак Ніна Богданівна, Семенович Володимир Костянтинович, Малієнко Вадим Анатолійович, Облап Руслан Васильович, Голубець Руслан Анатолійович

МПК: C12N 15/00

Мітки: визначення, вмісту, реальному, генетично, кількісного, харчових, ланцюгової, гмо, якісного, реакції, організмів, модифікованих, часі, тест-система, полімерної, продуктах, методом, плр-рч

Формула / Реферат:

Тест-система для визначення якісного та кількісного вмісту генетично модифікованих організмів (ГМО) в харчових продуктах методом полімеразної ланцюгової реакції в реальному часі (ПЛР-РЧ), яка містить набір реагентів для екстрагування ДНК, суміш для проведення полімеразної ланцюгової реакції, Taq-полімеразу, сертифіковані стандартні зразки ДНК трансгенних культур, яка відрізняється тим, що містить оригінальну панель олігонуклеотидних...

Спосіб діагностики мvx методом мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 68996

Опубліковано: 25.04.2012

Автори: Мельничук Максим Дмитрович, Антіпов Ігор Олександрович, Іванова Тетяна Василівна

МПК: C12Q 1/68

Мітки: реакції, методом, мультиплексної, полімеразної, ланцюгової, діагностики, спосіб

Формула / Реферат:

Спосіб діагностики MVX методом мультиплексної полімеразної ланцюгової реакції, що включає відбір зразків, екстракцію длРНК із зразків, реакцію зворотної транскрипції, проведення полімеразної ланцюгової реакції (ПЛР), візуалізацію та аналіз результатів, який відрізняється тим, що для проведення ПЛР використовується дві пари праймерів, одна пара АВ 18s_fl TAGGATAGAGGCCTACCA і АВ 18s_rl TTCGCAGTAGTCGGTCTTGA специфічна до послідовності до 18S...

Спосіб використання мультиплексної полімеразної ланцюгової реакції для визначення пародонтопатогенної флори

Завантаження...

Номер патенту: 65337

Опубліковано: 12.12.2011

Автори: Ізмайлова Ольга Ваталіївна, Шликова Оксана Анатоліївна, Весніна Людмила Едуардівна, Кайдашев Ігор Петрович, Боброва Нелля Олександрівна

МПК: G01N 33/00

Мітки: полімеразної, спосіб, ланцюгової, мультиплексної, використання, флори, визначення, пародонтопатогенної, реакції

Формула / Реферат:

Спосіб використання мультиплексної полімеразної ланцюгової реакції для визначення наявності та співвідношення окремих мікроорганізмів, який відрізняється тим, що визначення проводять в порожнині рота, як мікроорганізми визначають - Lactobacillus spp./BK, Enterobacterium spp., Streptococcus spp., Gardnerella vaginalis/Prevotella bivia/Porphyromonas spp., Eubacterium spp., Mycoplasma genitalium+hominis, Candida spp.., а полімеразну ланцюгову...

Спосіб екстракції днк з матеріалу рослинного походження для генетичного аналізу за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 62611

Опубліковано: 12.09.2011

Автори: Стегній Борис Тимофійович, Герілович Антон Павлович, Солодянкін Олексій Сергійович, Сапко Світлана Анатоліївна

МПК: C12N 7/00

Мітки: ланцюгової, реакції, полімеразної, допомогою, походження, днк, екстракції, аналізу, матеріалу, рослинного, спосіб, генетичного

Формула / Реферат:

Спосіб екстракції ДНК з матеріалу рослинного походження для генетичного аналізу за допомогою полімеразної ланцюгової реакції, що включає лізис клітин бромистим цетилтриметиламонієм, сорбцію ДНК на діоксид кремнію, дворазове відмивання діоксиду кремнію 70 % етанолом, який відрізняється тим, що на кінцевій стадії відмивання використовують хлороформ з ізопропанолом.

Спосіб екстракції днк з крові хребетних для генетичного аналізу за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 62610

Опубліковано: 12.09.2011

Автори: Солодянкін Олексій Сергійович, Герілович Антон Павлович, Стегній Борис Тимофійович

МПК: C12N 7/00

Мітки: спосіб, ланцюгової, генетичного, реакції, екстракції, крові, полімеразної, днк, хребетних, допомогою, аналізу

Формула / Реферат:

Спосіб екстракції ДНК з крові хребетних для генетичного аналізу за допомогою полімеразної ланцюгової реакції, що включає лізис еритроцитів, сорбцію ДНК на діоксид кремнію, центрифугування та відмивання ДНК, який відрізняється тим, що на етапі селективного лізису еритроцитів використовують розчин хлориду амонію, калію гідрокарбонату.

Спосіб екстракції днк з тканин тваринного походження для генетичного аналізу за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 62609

Опубліковано: 12.09.2011

Автори: Стегній Борис Тимофійович, Солодянкін Олексій Сергійович, Сапко Світлана Анатоліївна, Герілович Антон Павлович

МПК: C12N 7/00

Мітки: походження, генетичного, допомогою, днк, тваринного, ланцюгової, тканин, реакції, полімеразної, спосіб, екстракції, аналізу

Формула / Реферат:

Спосіб екстракції ДНК з тканин тваринного походження для генетичного аналізу за допомогою полімеразної ланцюгової реакції, що включає ферментативний метод дезінтеграції тканин, який відрізняється тим, що для протеолітичної обробки використовують розчин трипсину, фільтрують клітини від грубих механічних домішок, лізують клітини гуанідином тіоціанатом, сорбцію ДНК проводять на діоксиді кремнію та дворазово відмивають діоксид кремнію 70 %...

Спосіб визначення трансгенної лінії ga21 кукурудзи за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 61602

Опубліковано: 25.07.2011

Автори: Кучук Микола Вікторович, Сатарова Тетяна Миколаївна, Борисова Вікторія Вікторівна, Моргун Богдан Володимирович, Банникова Марія Олександрівна

МПК: C12N 15/00

Мітки: допомогою, визначення, трансгенної, кукурудзи, реакції, лінії, спосіб, ланцюгової, полімеразної

Формула / Реферат:

Спосіб детекції мутантного гена 5-енолпірувіл шікімат-3-фосфат синтази кукурудзи (Zea mays L.) у генетично модифікованій рослині методом полімеразної ланцюгової реакції, для здійснення якої проводять термальну денатурацію рослинної ДНК; циклічну ампліфікацію, де кожен цикл включає денатурацію ДНК, ренатурацію рослинної ДНК з олігонуклеотидними праймерами, синтез фрагментів цільових генів; синтез фрагментів цільових генів, для проведення...

Спосіб виявлення плазмід pхо1 та pхо2 в складі бактерій bacillus anthracis за допомогою мультиплексної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 55775

Опубліковано: 27.12.2010

Автори: Дерябін Олег Миколайович, Бєднов Максим Олександрович, Скрипнік Артем Валерійович, Дерябіна Олена Григорівна

МПК: A61K 39/27

Мітки: плазмід, мультиплексної, anthracis, реакції, pхо2, полімеразної, bacillus, спосіб, бактерій, pхо1, допомогою, виявлення, ланцюгової, складі

Формула / Реферат:

Спосіб виявлення ДНК плазмід рХО1 та рХО2 в складі бактерій Bacillus anthracis, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) за допомогою мультиплексного варіанту полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно синтезовані олігонуклеотидні праймери з наступною послідовністю нуклеотидів:для плазміди рХО1 (ген протективного...

Спосіб виявлення рнк вірусу геморагічної септицемії форелі за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 54336

Опубліковано: 10.11.2010

Автори: Гайдей Ольга Сергіївна, Головко Анатолій Миколайович, Дерябін Олег Миколайович, Ушкалов Валерій Олександрович, Бабкін Михайло Валерійович

МПК: A61K 39/39

Мітки: реакції, зворотно-транскриптазної, форелі, спосіб, рнк, виявлення, полімеразної, допомогою, ланцюгової, геморагічної, септицемії, вірусу

Формула / Реферат:

Спосіб виявлення РНК вірусу геморагічної септицемії форелі за допомогою полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (РНК) за допомогою зворотно-транскриптазної полімеразної ланцюгової реакції (ЗТ-ПЛР), який відрізняється тим, що для проведення ЗТ-ПЛР використовують штучно синтезовані вироджені олігонуклеотидні праймери з наступною послідовністю...