Патенти з міткою «ланцюговий»

Спосіб індикації днк бактерії chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 123070

Опубліковано: 12.02.2018

Автори: Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович, Корнієнко Марина Володимирівна

МПК: A61K 39/118, C12R 1/01, C12Q 1/68 ...

Мітки: днк, шляхом, ампліфікації, головного, ланцюговий, білка, фрагменту, видової, диференціації, момр, індикації, реакції, chlamydia, спосіб, мембрани, бактерії, avium, полімеразній, гена

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia avium здійснюють за допомогою пари праймерів: прямого: ChAvMOMPL: 5' - TTCTGGTGATCCTTGCGACC-3' та зворотного: ChAvMOMPR: 5'- GCTCCTAAAGTTGCACAACC - 3', з одержанням...

Ланцюговий транспортер циліндричних виробів ротаційної тамподрукарської машини

Завантаження...

Номер патенту: 121591

Опубліковано: 11.12.2017

Автори: Лещенко Анна Сергіївна, Віхоть Олексій Миколайович

МПК: B65G 15/00, B41F 31/00, B41F 17/00 ...

Мітки: транспортер, ланцюговий, тамподрукарської, циліндричних, виробів, ротаційної, машини

Формула / Реферат:

Ланцюговий транспортер циліндричних виробів ротаційної тамподрукарської машини, що містить ланцюг, зірочки, який відрізняється тим, що має пару роликів для обертання циліндричного виробу під час перенесення зображення тампонним циліндром на циліндричний виріб.

Спосіб індикації шести та диференціації трьох видів збудників бабезіозів тварин у мультиплексній полімеразній ланцюговій реакції

Завантаження...

Номер патенту: 118964

Опубліковано: 11.09.2017

Автори: Почерняєв Костянтин Федорович, Курман Андрій Федорович, Ксьонз Ігор Миколайович, Мокрий Юрій Олексійович

МПК: C12Q 1/68, C12R 1/90

Мітки: тварин, спосіб, видів, шести, трьох, диференціації, індикації, ланцюговий, бабезіозів, реакції, полімеразній, збудникiв, мультиплексній

Формула / Реферат:

Спосіб визначення ДНК найпростіших роду Babesia у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена 18S рРНК, який відрізняється тим, що ампліфікацію означеного фрагмента гена 18S рРНК представників роду Babesia шести видів та видову диференціацію трьох із них здійснюють за допомогою системи олігонуклеотидних праймерів - двох прямих: BCANF 5'-GTGACCCAAACCCTCACCAGA-3' і BSPF 5'-ССА-TTGGAGGGCAAGTCTGGT-3' та трьох зворотних:...

Ланцюговий привід для ланкових ланцюгів забійних конвеєрів або видобувальних машин

Завантаження...

Номер патенту: 114759

Опубліковано: 25.07.2017

Автори: Браун Еберхард, Браун Дітріх

МПК: B65G 23/06, F16H 57/00, F16H 55/30 ...

Мітки: машин, видобувальних, привід, ланцюгів, ланкових, забійних, ланцюговий, конвеєрів

Формула / Реферат:

1. Ланцюговий привід для ланкових ланцюгів забійних конвеєрів або видобувальних машин, зокрема для скребкових ланцюгових конвеєрів, з привідним валом (3) і елементами (4), які виконують функції зубів зірочки, при цьому елементи (4), які виконують функцію зубів зірочки, встановлені в гнізда (6) на привідному валу (3), який відрізняється тим, що гнізда (6) мають глибину (X) і елементи (4), які виконують функцію зубів зірочки, мають висоту (Y)...

Спосіб індикації днк бактерії chlamydia pneumoniae у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 117492

Опубліковано: 26.06.2017

Автори: Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: A61K 39/118

Мітки: ланцюговий, диференціації, полімеразній, бактерії, ампліфікації, pneumoniae, головного, мембрани, індикації, реакції, днк, білка, chlamydia, гена, фрагмента, видової, спосіб, шляхом, момр

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia рnеumoniae у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia рnеumoniae здійснюють за допомогою пари праймерів: прямого: ChPnMOMPL: 5'-GGAACAAAGTCTGCGACCAT-3' та зворотного: ChPnMOMPR: 5'-AAAGAAGGGTTCCATGCAGTT-3', з...

Пристрій для передачі рулону з вала барабана моталки на ланцюговий конвеєр

Завантаження...

Номер патенту: 117446

Опубліковано: 26.06.2017

Автори: Попович Олег Леонідович, Ростовський Костянтин Леонідович, Царьов Андрій Володимирович, Санжаревський Олег Васильович, Чехлань Володимир Вікторович

МПК: B21C 47/24

Мітки: барабана, пристрій, конвеєр, вала, ланцюговий, передачі, моталки, рулону

Формула / Реферат:

Пристрій для передачі рулону з вала барабана моталки на ланцюговий конвеєр, що містить повідний візок, корпус, який шарнірно зчленований з поворотною Ш-подібною рамою, та приймальні ролики, який відрізняється тим, що корпус із поворотною Ш-подібною рамою закріплений окремо від повідного візка й оснащений двома симетричними утримуючими упорами, виконаними з можливістю висування та контакту з рулоном, установленим на приймальних роликах...

Спосіб індикації днк бактерії chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117100

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: C12R 1/01, C12Q 1/68

Мітки: головного, бактерії, білка, мембрани, pecorum, диференціації, індикації, гена, спосіб, chlamydia, полімеразній, ампліфікації, шляхом, ланцюговий, фрагмента, видової, момp, реакції, днк

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia pecorum здійснюють за допомогою пари праймерів: прямого: ChPecMOMPL 5'-TCCAATACGCACAATCGAAA-3' та зворотного: ChPecMOMPR 5'-GTAAGACAACGCTGCACCAA-3', з одержанням...

Спосіб індикації днк бактерії chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117099

Опубліковано: 12.06.2017

Автори: Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна

МПК: C12Q 1/68, C12R 1/01

Мітки: момp, фрагмента, бактерії, днк, індикації, білка, ланцюговий, гена, головного, реакції, шляхом, полімеразній, диференціації, видової, спосіб, мембрани, chlamydia, ампліфікації

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia suis здійснюють за допомогою пари праймерів: прямого: ChSuMOMPL: 5'- TTCTTTGCAATGCTGCTGAA-3' та зворотного: ChSuMOMPR: 5'- ATCAAAGCTTGCTCGAGACC-3', з одержанням...

Спосіб індикації днк бактерії chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 117097

Опубліковано: 12.06.2017

Автори: Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна

МПК: C12R 1/01, C12Q 1/68

Мітки: chlamydia, видової, спосіб, момр, мембрани, гена, ланцюговий, диференціації, psittaci, реакції, бактерії, білка, полімеразній, ампліфікації, індикації, шляхом, головного, фрагмента, днк

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia psittaci здійснюють за допомогою пари праймерів: прямого: ChPsMOMPL: 5'-GCACTATGTGGGAAGGTGCT-3' та зворотного: ChPsMOMPR: 5'-CCATTTGCTTCTGGCTGATT-3', з одержанням...

Спосіб індикації днк бактерії chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117091

Опубліковано: 12.06.2017

Автори: Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна

МПК: C12Q 1/68, C12R 1/01

Мітки: ланцюговий, диференціації, індикації, chlamydia, видової, ампліфікації, шляхом, спосіб, фрагмента, момp, днк, бактерії, полімеразній, мембрани, реакції, білка, гена, головного, abortus

Формула / Реферат:

Спосіб індикації ДНК бактерій Chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР) для її видової диференціації, який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia abortus здійснюють за допомогою пари праймерів: прямого: ChAbMOMPL: 5'-GGATAGACCCAACATCGCTT-3' та зворотного: ChAbMOMPR:...

Ланцюговий редуктор

Завантаження...

Номер патенту: 114379

Опубліковано: 10.03.2017

Автор: Гузенко Юрій Михайлович

МПК: F16H 1/00

Мітки: ланцюговий, редуктор

Формула / Реферат:

Ланцюговий редуктор, що містить корпус, розміщені в ньому ведучу і ведену зірочки, а також охоплюючий їх трирядний ланцюг, при цьому одну зірочку виконано одинарною, а другу зірочку - здвоєною, який відрізняється тим, що здвоєною виконано ведучу зірочку, а одинарною - ведену зірочку, при цьому ведуча зірочка взаємодіє з двома крайніми рядами трирядного ланцюга, а ведена зірочка з його середнім рядом.

Ланцюговий конвеєр

Завантаження...

Номер патенту: 106410

Опубліковано: 25.04.2016

Автори: Музичишин Сергій Володимирович, Павленко Георгій Іванович, Піпа Борис Федорович

МПК: B65G 17/00

Мітки: ланцюговий, конвеєр

Формула / Реферат:

Ланцюговий конвеєр, що містить приводну і ведену зірочки, ланцюг з робочою та холостою гілками, що охоплює зірочки, робочі органи, шарнірно прикріплені до ланцюга, верхню та нижню направляючі, на яких розташовані відповідно робоча та холоста гілки ланцюга, який відрізняється тим, що частина холостої гілки ланцюга вільно провисає між приводною зірочкою і нижньою направляючою, при цьому відстань кінця нижньої направляючої від осі приводної...

Спосіб визначення днк бактерій виду chlamydia abortus, chlamydia pecorum, chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу р (rnase p rna)

Завантаження...

Номер патенту: 110546

Опубліковано: 12.01.2016

Автори: Цівенко Тетяна Михайлівна, Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: C12Q 1/68, C12R 1/01

Мітки: ендорибонуклеазу, гена, кодує, chlamydia, rnase, фрагмента, бактерій, виду, днк, ампліфікації, шляхом, спосіб, полімеразній, визначення, реакції, psittaci, ланцюговий, pecorum, abortus

Формула / Реферат:

Спосіб визначення ДНК бактерій виду Chlamydia abortus, Chlamydia pecorum, Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу Р (RNase Р RNA), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки фрагмента гена RNase Р RNA здійснюють за допомогою пари праймерів: прямого:CHCPF:5`-GGAGAAACTCCAGGGGCCGT-3` та зворотного:...

Спосіб визначення днк бактерій chlamydia felis у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр)

Завантаження...

Номер патенту: 109489

Опубліковано: 25.08.2015

Автори: Цівенко Тетяна Михайлівна, Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: C12Q 1/68, C12R 1/01

Мітки: полімеразній, бактерій, chlamydia, днк, мембрани, головного, шляхом, фрагменту, спосіб, ампліфікації, ланцюговий, felis, білка, визначення, гена, реакції, момр

Формула / Реферат:

Спосіб визначення ДНК збудника хламідійних інфекцій домашніх котів у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки ДНК МОМР бактерії Chlamydia felis здійснюють з використанням пари праймерів: прямого CHFMF 5'-GCAGCTTCTGGAACTGCAAGC-3' та зворотного CHFMR 5'-GGCGАААТСAGTTCCTGCAAGА-3' з одержанням...

Ланцюговий транспортний конвеєр для транспортування рулонів

Завантаження...

Номер патенту: 101101

Опубліковано: 25.08.2015

Автори: Єлецьких Володимир Іванович, Барабаш Андрій Володимирович, Євгиненко Ігор Олександрович, Каушанський Ігор Борисович, Бердніков Олег Костянтинович

МПК: B65G 17/06, B65G 17/44

Мітки: рулонів, ланцюговий, транспортний, транспортування, конвеєр

Формула / Реферат:

Ланцюговий транспортний конвеєр для транспортування рулонів, що містить два паралельні ланцюги, складені із шарнірно з'єднаних ланок, які зв'язані із приводними й неробочими зірочками, й опираються на робочі та неробочі підтримувальні ролики, установлені на рамі конвеєра, який відрізняється тим, що ланки обох ланцюгів, які розташовані симетрично, обладнані вантажотримальними ложементами, що утворюють жолоб під рулон, що транспортується, при...

Ланцюговий траншеєкопач для розкривання підземних трубопроводів

Завантаження...

Номер патенту: 92817

Опубліковано: 10.09.2014

Автори: Бібішев Ігор Сергійович, Анісімов Вадим Борисович, Шалата Максим Васильович, Лисак Сергій Іванович, Опалко В'ячеслав Олександрович

МПК: E02F 5/00

Мітки: підземних, ланцюговий, трубопроводів, розкривання, траншеєкопач

Формула / Реферат:

Ланцюговий траншеєкопач для розкривання підземних трубопроводів, що містить базову машину, до якої шарнірно приєднано підйомно-опускну раму, що жорстко зв'язана з двома ланцюговими секціями, встановленими під різними кутами нахилу до забою в повздовжній площині із можливістю повороту за допомогою механізмів повороту та слідкуючий засіб, який відрізняється тим, що зі сторін внутрішніх частин рам ланцюгових секцій на рівні трубопроводу...

Ланцюговий холодильник

Завантаження...

Номер патенту: 85793

Опубліковано: 25.11.2013

Автори: Чехлань Володимир Вікторович, Титаренко Олександр Іванович, Царьов Андрій Володимирович, Прохоренко Олександр Володимирович, Бабій Сергій Антонович, Гончаренко Анжела Федорівна

МПК: B21B 43/00

Мітки: ланцюговий, холодильник

Формула / Реферат:

Ланцюговий холодильник, що містить ряд паралельних привідних замкнених ланцюгів з підтримуючими напрямними, послідовно розташованими уздовж верхніх гілок ланцюгів, який відрізняється тим, що він обладнаний ґратчастими настильними плитами, які закріплені на стаціонарно встановлених для них опорних рамах, розташованих між паралельними підтримуючими напрямними, крім того, обладнаний підтримувальними роликами, установленими під нижньою гілкою...

Ланцюговий прес

Завантаження...

Номер патенту: 77693

Опубліковано: 25.02.2013

Автори: Волчко Андрій Анатолійович, Павлов Сергій Олексійович, Гавва Олександр Миколайович, Рафальська Наталія Юріївна, Головченко Олександр Олександрович, Волчко Анатолій Іванович

МПК: B30B 5/00, B30B 9/30

Мітки: ланцюговий, прес

Формула / Реферат:

Ланцюговий прес, який складається з нескінченних металевих ланцюгів, які охоплюють, встановлені на валах, приводні та натяжні зірочки із закріпленими на ланцюгах пластинами, який відрізняється тим, що пластини закріплені з однаковим кроком t по всій довжині ланцюгів, а ланцюги від протилежних приводних валів рухаються з різними швидкостями V при цьому ступінь пресування

Ланцюговий привід

Завантаження...

Номер патенту: 71899

Опубліковано: 25.07.2012

Автори: Харченко Олег Володимирович, Харченко Володимир Іванович, Харченко Олексій Володимирович

МПК: B62K 7/00, B62M 1/00, B62M 9/00 ...

Мітки: ланцюговий, привід

Формула / Реферат:

Ланцюговий привід, що містить ведучу зірочку, вал педалей, маточину заднього колеса в зборі, змонтовану на нерухомій осі разом з механізмом обгінної муфти і гальма, ведену зірочку і ланцюг для охоплювання зазначених зірочок, який відрізняється тим, що додатково оснащений другим ступенем ланцюгового приводу, що містить другу ведучу зірочку, яка нерухомо зафіксована на зовнішній поверхні втулки маточини на стороні важеля гальма, другу ведену...

Гнучкий ланцюговий конвеєр

Завантаження...

Номер патенту: 52568

Опубліковано: 25.08.2010

Автори: Гевко Ігор Богданович, Олексишин Олексій Володимирович, Гевко Богдан Матвійович, Диня Володимир Іванович, Ляшук Олег Леонтійович, Стефанів Володимир Михайлович, Дячун Андрій Євгенович

МПК: B65G 33/00

Мітки: конвеєр, ланцюговий, гнучкий

Формула / Реферат:

Гнучкий ланцюговий конвеєр, що виконаний у вигляді труби, в яку встановлений гнучкий ланцюговий дисковий робочий орган з круглими дисками з можливістю осьового переміщення, приводу, бункера, завантажувально-розвантажувальних пристроїв, ємності для збирання транспортованої сировини, який відрізняється тим, що труба виконана вигляді U-подібної форми круглого поперечного перерізу, а привід оснащений спеціальною привідною зірочкою, що розміщена...

Спосіб визначення днк бактерій родини chlamydiaceae у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр)

Завантаження...

Номер патенту: 51635

Опубліковано: 26.07.2010

Автори: Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: A61K 39/118

Мітки: визначення, реакції, полімеразній, ланцюговий, днк, момр, бактерій, фрагмента, мембрани, родини, ампліфікації, спосіб, білка, гена, головного, chlamydiaceae, шляхом

Формула / Реферат:

Спосіб визначення ДНК бактерій родини Chlamydiaceae у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани(МОМР), який відрізняється тим, що при цьому у полімеразній ланцюговій реакції ампліфікується однакова за нуклеотидним складом ділянка ДНК з молекулярною масою - 221 пари нуклеотидів бактерій родини Chlamydiacea, що викликають захворювання у ссавців і птахів незалежно від їх виду.

Ланцюговий редуктор

Завантаження...

Номер патенту: 50509

Опубліковано: 10.06.2010

Автори: Тарасенко Анатолій Іванович, Піпа Борис Федорович

МПК: F16H 1/02

Мітки: редуктор, ланцюговий

Формула / Реферат:

Ланцюговий редуктор, що містить ведучу і ведену зірочки, кожна з яких має зубчастий вінець, та роликовий ланцюг, що їх охоплює, який відрізняється тим, що ведена зірочка додатково обладнана другим зубчастим вінцем, а роликовий ланцюг виконаний трирядним.

Ланцюговий скребковий конвеєр

Завантаження...

Номер патенту: 46635

Опубліковано: 25.12.2009

Автор: Вернохаєв Дмитро Павлович

МПК: B65G 19/24

Мітки: ланцюговий, скребковий, конвеєр

Формула / Реферат:

1. Ланцюговий скребковий конвеєр, що включає транспортний жолоб та принаймні один центрально розташований на його основі тяговий ланцюг, який складений із вертикально та горизонтально розташованих кілець, із скребками, кожен з яких розташований кінцевими ділянками в напрямних боковинах транспортного жолоба, скребок виконаний з виїмками для розміщення горизонтального кільця ланцюга та закріплений на кільці за допомогою скоби, та розміщені у...

Ланцюговий замок

Завантаження...

Номер патенту: 88765

Опубліковано: 25.11.2009

Автори: Далферт Ганс, Нудінг Андреас, Ланг Вернер

МПК: F16G 15/00

Мітки: замок, ланцюговий

Формула / Реферат:

1. Ланцюговий замок для з'єднання ланкових ланцюгів з двома з'єднуючими частинами (1) замка, рухомими одна до одної в обмеженому ступені в подовжньому напрямку замка для відкриття та закриття замка, кожна з яких має з'єднані поздовжньою перемичкою (2) один з одним два кінці, з яких один утворює стійку (5) з контрувальною перегородкою (7), що займає частину периметра стійки, а інший забезпечений прорізом (6) для розміщення стійки (5) і має...

Ланцюговий замок

Завантаження...

Номер патенту: 88142

Опубліковано: 25.09.2009

Автори: Нудінг Андреас, Ланг Вернер, Далферт Ганс

МПК: F16G 15/00

Мітки: ланцюговий, замок

Формула / Реферат:

1. Ланцюговий замок для ланкових ланцюгів з двома з'єднуючими частинами (1, 2) замка, рухомими одна відносно одної в обмеженому ступені в поздовжньому напрямку замка для відкриття і закриття замка, кожна з яких має зв'язані поздовжньою перемичкою (3) один з одним два кінці, один з яких утворює стійку (6) з контрувальною перегородкою (8), що займає частину периметра стійки, а інший забезпечений прорізом (7) для розміщення стійки (6) і має...

Ланцюговий конвеєр

Завантаження...

Номер патенту: 41860

Опубліковано: 10.06.2009

Автори: Марченко Анатолій Іванович, Піпа Борис Федорович, Хомяк Олег Миколайович

МПК: B65G 17/00

Мітки: конвеєр, ланцюговий

Формула / Реферат:

Ланцюговий конвеєр, що містить дві приводні і дві натяжні зірочки, два замкнені ланцюги, що їх охоплюють, та осі, що з'єднують між собою ланцюги, який відрізняється тим, що кожна вісь виконана у вигляді двох півосей, причому кінець однієї півосі виконано трубчастим, в якому вільно встановлено кінець другої півосі.

Ланцюговий скребковий конвеєр

Завантаження...

Номер патенту: 37081

Опубліковано: 10.11.2008

Автор: Вернохаєв Дмитро Павлович

МПК: B65G 19/24

Мітки: ланцюговий, скребковий, конвеєр

Формула / Реферат:

1. Ланцюговий скребковий конвеєр, що включає транспортний жолоб, розташований на його основі тяговий ланцюг із скребками, кожний з яких розміщений кінцевими ділянками в напрямних боковинах транспортного жолоба, скребок виконаний з виїмками для розміщення горизонтального кільця ланцюга та скоби, виконаної з виступами, нарізні кінці, які розміщені у отворах скребків, який відрізняється тим, що скоба та нарізні кінці жорстко з'єднані між собою,...

Спосіб визначення днк семи збудників хламідійних інфекцій ссавців і птахів у одній полімеразній ланцюговій реакції

Завантаження...

Номер патенту: 34868

Опубліковано: 26.08.2008

Автори: Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: A61K 39/118

Мітки: збудникiв, семи, полімеразній, реакції, ссавців, ланцюговий, одний, хламідійних, визначення, днк, спосіб, птахів, інфекцій

Формула / Реферат:

Спосіб визначення ДНК збудників хламідійних інфекцій у полімеразній ланцюговій реакції (ПЛР), який відрізняється тим, що у одній полімеразній ланцюговій реакції виявляється ділянка ДНК семи видів бактерій родини Chlamydiacea, що викликають захворювання у ссавців і птахів.

Ланцюговий конвеєр

Завантаження...

Номер патенту: 31410

Опубліковано: 10.04.2008

Автори: Коньков Георгій Ігорович, Марченко Анатолій Іванович, Піпа Борис Федорович

МПК: B65G 17/00

Мітки: ланцюговий, конвеєр

Формула / Реферат:

Ланцюговий конвеєр, що містить приводну і ведену зірочки, замкнений ланцюг, що їх охоплює, робочі органи, шарнірно прикріплені до ланцюга, та верхні і нижні напрямні, на яких розташовані відповідно робоча та холоста гілки ланцюга з робочими органами, який відрізняється тим, що холоста гілка ланцюга з робочими органами вільно провисає між точкою сходу її з приводної зірочки і нижніми напрямними, причому відстань кінця нижньої напрямної від...

Ланцюговий конвеєр

Завантаження...

Номер патенту: 31400

Опубліковано: 10.04.2008

Автори: Піпа Борис Федорович, Ловейкіна Світлана Олексіївна, Коньков Георгій Ігорович

МПК: B65G 17/00

Мітки: ланцюговий, конвеєр

Формула / Реферат:

Ланцюговий конвеєр, що містить приводну станцію з приводною зірочкою, натяжну станцію з натяжною зірочкою, натяжний пристрій натяжної зірочки, виконаний у вигляді гвинтової пари, з двома напрямними з повзунами, в підшипниках яких розташована вісь натяжної зірочки, та замкнений ланцюг, що охоплює приводну та натяжну зірочки, а гвинт кінематично з'єднаний з повзунами, який відрізняється тим, що гвинт гвинтової пари містить вісь, рівновіддалену...

Безбалансирний ланцюговий привід для заглибних поршневих насосів

Завантаження...

Номер патенту: 78787

Опубліковано: 25.04.2007

Автори: Лексиков Олександр Анатолійович, Кожевников Анатолій Олександрович, Тітов Володимир Ілліч, Фатов Олександр Петрович, Камишацький Олександр Федорович

МПК: F04B 47/02, E21B 43/00

Мітки: насосів, привід, ланцюговий, безбалансирний, поршневих, заглибних

Формула / Реферат:

Безбалансирний привід для заглибних поршневих насосів, який включає ланцюгові передачі з парами обхоплюваних ланцюгами ведених та ведучих зірочок, останні з яких встановлено співвісно, і  проміжний елемент, який зв'язаний з гнучкою тягою контрвантажу та вантажною гілкою трансмісії, який відрізняється тим, що введено амортизатор, а ведучі та ведені зірочки виконано однаковими і вони рухомо зв'язані між собою та проміжним елементом, з...

Ланцюговий механізм

Завантаження...

Номер патенту: 19500

Опубліковано: 15.12.2006

Автор: Колотуша Петро Федорович

МПК: F16H 9/00

Мітки: механізм, ланцюговий

Формула / Реферат:

1. Ланцюговий механізм для перетворення зворотно-поступального руху в обертальний, який містить дві опозитно розташовані обгінні муфти на вихідному валу, який відрізняється тим, що обойми обгінних муфт виконані в вигляді зубчастих зірочок, які провертаються ланцюгами, закріпленими на консолях штовхача, і почергово через заклинюючі ролики обертають зірочки обгінних муфт, постійно створюючи навантажений обертовий момент в одному напрямку на...

Ваговий ланцюговий конвеєр

Завантаження...

Номер патенту: 75164

Опубліковано: 15.03.2006

Автор: Хефнер Ханс Вільгельм

МПК: B65G 19/10, B65G 19/22, B65G 17/16 ...

Мітки: ланцюговий, конвеєр, ваговий

Формула / Реферат:

1. Ланцюговий конвеєр для гравіметричного вимірювання/дозування, зокрема сипких матеріалів, який містить корпус-лоток з принаймні двома привідними ланцюгами з прикріпленими до них рейкоподібними захватами, а також завантажувальний отвір та випускний отвір у корпусі-лотку, де між завантажувальним та випускним отворами встановлено принаймні один вимірювальний місток, що спирається на силовимірювальний пристрій, який відрізняється тим, що...

Ланцюговий льонобральний апарат

Завантаження...

Номер патенту: 75227

Опубліковано: 15.03.2006

Автори: Юхимчук Сергій Федорович, Юхимчук Світлана Миколаївна

МПК: A01D 45/06

Мітки: апарат, льонобральний, ланцюговий

Формула / Реферат:

Ланцюговий льонобральний апарат, що містить раму і закріплені на ній подільники, бральний та вивідний пристрої, який відрізняється тим, що бральний пристрій виконаний у вигляді ланцюгової передачі, на якій встановлені бральні ролики та бральні пластини, які обладнані гумовими підтримувачами, а знизу робочої вітки ланцюгової передачі встановлений опорний транспортер у вигляді бігової доріжки, крім того, за бральними роликами розташований...

Привід педально-ексцентриковий ланцюговий

Завантаження...

Номер патенту: 74857

Опубліковано: 15.02.2006

Автори: Онищенко Євген Євгенович, Онищенко Володимир Євгенович, Онищенко Євген Євгенович (молодший)

МПК: B62M 11/00

Мітки: педально-ексцентриковий, ланцюговий, привід

Формула / Реферат:

1. Привід педально-ексцентриковий ланцюговий, що містить привідну зірочку, посаджену на один вал з педалями, ведену зірочку, ланцюг, накинутий на них, та підпружинений натяжний пристрій на неробочій гілці ланцюга, який відрізняється тим, що на робочій гілці ланцюга встановлена ексцентрикова зірочка із кількістю зубів удвоє меншою, ніж у привідній зірочці таким чином, що прогин ланцюга є найменшим у момент вертикального розташування...

Привід педально-кулачковий ланцюговий

Завантаження...

Номер патенту: 74856

Опубліковано: 15.02.2006

Автори: Онищенко Євген Євгенович (молодший), Онищенко Володимир Євгенович, Онищенко Євген Євгенович

МПК: B62M 11/00

Мітки: привід, ланцюговий, педально-кулачковий

Формула / Реферат:

1. Привід педально-кулачковий ланцюговий, що містить привідну зірочку, посаджену на один вал з педалями, ведену зірочку, ланцюг, накинутий на них, та підпружинений натяжний пристрій на неробочій гілці ланцюга, який відрізняється тим, що на одному валу з привідною зірочкою та педалями встановлено кулачок, виконаний у вигляді еліпса, мала вісь якого розташована уздовж осі важелів педалей, та який за допомогою двоплечого важеля взаємодіє з...

Спосіб визначення днк збудників хламідійних інфекцій у мультиплексній полімеразній ланцюговій реакції

Завантаження...

Номер патенту: 11834

Опубліковано: 16.01.2006

Автори: Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович, Курман Андрій Федорович

МПК: A61K 39/118

Мітки: збудникiв, ланцюговий, реакції, спосіб, інфекцій, днк, хламідійних, полімеразній, визначення, мультиплексній

Формула / Реферат:

Спосіб визначення ДНК збудників хламідійних інфекцій у мультиплексній полімеразній ланцюговій реакції, який відрізняється тим, що при цьому полімеразну ланцюгову реакцію використовують для визначення збудників хламідійних інфекцій тварин і птахів за видами.

Редуктор хвильовий ланцюговий

Завантаження...

Номер патенту: 9089

Опубліковано: 15.09.2005

Автор: Дорохов Микола Юрійович

МПК: F16G 13/00

Мітки: ланцюговий, хвильовий, редуктор

Формула / Реферат:

Редуктор хвильовий ланцюговий, до складу якого входить корпус, в якому розташовані дві нерухомі зірочки, співвісно з якими та між якими розміщено водило, що складається з двох фланців, яке встановлене на валу, закріпленому у корпусі на опорах, а між фланцями водила розміщені два робочих ролики на осях, які закріплені на фланцях водила, який відрізняється тим, що на валу редуктора ексцентрично встановлено два підшипники, на яких розташовано...

Ланцюговий волочильний стан для виготовлення довгомірних мідно-нікелевих труб

Завантаження...

Номер патенту: 8301

Опубліковано: 15.07.2005

Автори: Шпаковскій Вадім, Клюєв Сергій Петрович, Клюєв Андрій Петрович

МПК: B21C 1/00, B21C 3/00

Мітки: довгомірних, труб, мідно-нікелевих, ланцюговий, стан, виготовлення, волочильний

Формула / Реферат:

Ланцюговий волочильний стан для виготовлення довгомірних мідно-нікелевих труб, що складається з завантажувального стелажа, станини, нескінченного ланцюга, болта, напрямної труби, приймального стелажа, каретки з механізмом повернення, двигуна головного приводу стана, який відрізняється тим, що довжина завантажувального стелажа становить 11 м, довжина станини становить 17 м, довжина верхньої частини нескінченного ланцюга становить 19 м,...

Спосіб виділення днк мікобактерій з живильних середовищ для діагностики туберкульозу та мікобактеріозів в полімеразній ланцюговій реакції

Завантаження...

Номер патенту: 8094

Опубліковано: 15.07.2005

Автори: Скрипник Валерій Григорович, Скрипнік Артем Валерійович, Коваленко Анатолій Михайлович, Стегній Борис Тимофійович

МПК: G01N 33/00, A61K 39/04, G01N 33/53 ...

Мітки: днк, ланцюговий, середовищ, спосіб, реакції, живильних, діагностики, туберкульозу, виділення, мікобактеріозів, мікобактерій, полімеразній

Формула / Реферат:

Спосіб виділення ДНК мікобактерій з живильних середовищ для діагностики туберкульозу та мікобактеріозів в полімеразній ланцюговій реакції, що включає одночасну інактивацію та руйнування клітинної оболонки мікобактерій, який відрізняється тим, що на клітини здійснюють вплив температурою 99-100°С протягом 20 хвилин.