Патенти з міткою «гена»

Спосіб визначення мутацій гена notch1 у 3’utr некодуючому регіоні гена

Завантаження...

Номер патенту: 123082

Опубліковано: 12.02.2018

Автори: Білоус Надія Іванівна, Абраменко Ірина Вікторівна, Чумак Анатолій Андрійович

МПК: G01N 33/00, A61B 10/00

Мітки: 3'utr, спосіб, визначення, регіони, мутацій, гена, некодуючому, notch1

Формула / Реферат:

Спосіб визначення мутацій гена NOTCH 1 у 3'UTR некодуючому регіоні, що включає отримання генетичного матеріалу з клітин периферичної крові та проведення полімеразної ланцюгової реакції (ПЛР) з наступною рестрикцією отриманих продуктів реакції рестриктазою PfeI (TfiI), який відрізняється тим, що проведення ампліфікації відбувається з набором оригінальних праймерів (прямий праймер: CCGACCAGAGGAGCCTTTT; зворотний праймер: TAACAGGCAGGTGATGCTG),...

Спосіб індикації днк бактерії chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 123070

Опубліковано: 12.02.2018

Автори: Ксьонз Ігор Миколайович, Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович

МПК: A61K 39/118, C12R 1/01, C12Q 1/68 ...

Мітки: головного, мембрани, ампліфікації, avium, спосіб, фрагменту, ланцюговий, полімеразній, шляхом, chlamydia, бактерії, реакції, гена, момр, днк, білка, індикації, видової, диференціації

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia avium здійснюють за допомогою пари праймерів: прямого: ChAvMOMPL: 5' - TTCTGGTGATCCTTGCGACC-3' та зворотного: ChAvMOMPR: 5'- GCTCCTAAAGTTGCACAACC - 3', з одержанням...

Спосіб діагностики артеріальної гіпертензії в поєднанні з неалкогольною жировою хворобою печінки з поліморфізмом гена рецептора ангіотензину іі першого типу

Завантаження...

Номер патенту: 121299

Опубліковано: 27.11.2017

Автори: Зайцева Маріанна Михайлівна, Бабак Олег Якович

МПК: G01N 33/50, G01N 33/00

Мітки: ангіотензину, першого, діагностики, рецептора, хворобою, гена, артеріальної, поєднанні, печінки, неалкогольною, спосіб, гіпертензії, поліморфізмом, типу, жировою

Формула / Реферат:

Спосіб діагностики артеріальної гіпертензії у хворих із супутньою неалкогольною жировою хворобою печінки, який включає оцінку вимірів загально клінічних та інструментальних обстежень, який відрізняється тим, що для діагностики артеріальної гіпертензії в поєднанні з неалкогольною жировою хворобою печінки у хворого додатково оцінюють поліморфізм гена рецептора ангіотензину II першого типу (А1166С) та при наявності А/С генотипу діагностують...

Спосіб діагностики та прогнозування перебігу ревматоїдного артриту в поєднанні з абдомінальним ожирінням, артеріальною гіпертензією та цукровим діабетом типу 2 з урахуванням поліморфізму гена

Завантаження...

Номер патенту: 120866

Опубліковано: 27.11.2017

Автори: Букач Ольга Петрівна, Сидорчук Лариса Петрівна, Федів Олександр Іванович

МПК: G01N 33/50

Мітки: урахуванням, артеріальною, діабетом, цукровим, діагностики, поліморфізму, поєднанні, гіпертензією, ревматоїдного, прогнозування, типу, артриту, перебігу, гена, абдомінальним, ожирінням, спосіб

Формула / Реферат:

Спосіб діагностики та прогнозування перебігу ревматоїдного артриту в поєднанні з абдомінальним ожирінням, артеріальною гіпертензією та цукровим діабетом типу 2 з урахуванням поліморфізму гена шляхом визначення клінічних, біохімічних, гострофазових показників, визначення антитіл до циклічного цитрулінованого пептиду та ліпідного профілю, який відрізняється тим, що додатково визначають поліморфізм гена Т-786С eNOS; і при виявленні його...

Спосіб лікування ревматоїдного артриту в поєднанні з абдомінальним ожирінням, артеріальною гіпертензією та цукровим діабетом типу 2 та поліморфізмом гена t-786c enos

Завантаження...

Номер патенту: 120255

Опубліковано: 25.10.2017

Автори: Федів Олександр Іванович, Букач Ольга Петрівна, Сидорчук Лариса Петрівна

МПК: A61K 38/00, A61K 31/00

Мітки: лікування, типу, артеріальною, поліморфізмом, спосіб, гена, гіпертензією, ревматоїдного, t-786c, цукровим, ожирінням, артриту, абдомінальним, поєднанні, діабетом

Формула / Реферат:

Спосіб лікування ревматоїдного артриту в поєднанні з абдомінальним ожирінням, артеріальною гіпертензією, цукровим діабетом типу 2 та поліморфізмом гена Т-786С eNOS СС-генотипу шляхом призначення базисної терапії, в основі якої лежить застосування метотрексату, який відрізняється тим, що додатково призначають блокатор рецепторів AT II у дозі 80 мг 1 раз на добу зранку, статин у дозі 20 мг 1 раз на добу ввечері та L-аргінін 15 мл по 1 мірній...

Спосіб боротьби з грибами та ооміцетами шляхом інгібування гена сахаропіндегідрогенази

Завантаження...

Номер патенту: 115132

Опубліковано: 25.09.2017

Автори: Ессігманн Бернд, Паже Ерік, Шмітт Фредерік, Дорме Сесіль, Вілалба Француа, Делебарре Томас

МПК: C12N 15/113, A01H 5/00, C12N 15/82 ...

Мітки: шляхом, ооміцетами, боротьби, сахаропіндегідрогенази, спосіб, гена, інгібування, грибами

Формула / Реферат:

1. Молекула длРНК, яка містить і) перший ланцюг, що містить послідовність, щонайменше на 95 % ідентичну до щонайменше 18 суміжних нуклеотидів гена сахаропіндегідрогенази гриба або ооміцета, та іі) другий ланцюг, що містить послідовність, комплементарну до понад щонайменше 80 % нуклеотидів першого ланцюга, де ген гриба або ооміцета вибирають із групи, що складається з:a) полінуклеотиду, що містить послідовність, вказану у SEQ ID NO: 1,...

Спосіб лікування загрозливого аборту у жінок залежно від поліморфізму гена рецептора прогестерону rs590688

Завантаження...

Номер патенту: 118305

Опубліковано: 25.07.2017

Автор: Кривопустов Олександр Сергійович

МПК: C12N 15/00, A61K 31/00

Мітки: поліморфізму, загрозливого, спосіб, жінок, rs590688, прогестерону, гена, рецептора, залежно, аборту, лікування

Формула / Реферат:

Спосіб лікування загрозливого аборту у жінок залежно від поліморфізму гена рецептора прогестерону rs590688, що включає призначення натурального мікронізованого прогестерону, який відрізняється тим, що натуральний мікронізований прогестерон призначають в дозі 100 мг 3 рази на добу перорально при наявності у жінки гетерозиготи CG або мінорної гомозиготи GG та в дозі 200 мг 3 рази на добу перорально при наявності мажорної гомозиготи СС.

Спосіб прогнозування розвитку загрозливого аборту у жінок з урахуванням поліморфізму гена прогесторонового рецептора

Завантаження...

Номер патенту: 118250

Опубліковано: 25.07.2017

Автор: Кривопустов Олександр Сергійович

МПК: A61B 5/00, C12N 15/00

Мітки: загрозливого, спосіб, гена, прогнозування, жінок, аборту, прогесторонового, поліморфізму, рецептора, урахуванням, розвитку

Формула / Реферат:

Спосіб прогнозування розвитку загрозливого аборту у жінок з урахуванням поліморфізму гена прогестеронового рецептора, який відрізняється тим, що включає визначення рівня сприйняття стресу за шкалою Perceived Stress Scale (PSS) та алельного варіанта за поліморфізмом гена рецептора прогестерону rs 590688 методом полімеразної ланцюгової реакції, за якими розраховують ймовірність розвитку загрозливого аборту "р" за...

Конструкція для сайленсингу гена p0 та її застосування

Завантаження...

Номер патенту: 114603

Опубліковано: 10.07.2017

Автори: Веєн Гай, Граф Веронік, Жільмер Давід, Люфевр Марк, Кляйн Елоді, Бро Веронік

МПК: C12N 15/82

Мітки: сайленсингу, застосування, конструкція, гена

Формула / Реферат:

1. Конструкція РНК, що містить послідовність смислового сегмента і послідовність антисмислового сегмента, які мають послідовності, одержані на основі гена Р0 геному BMYV (вірус слабкого пожовтіння буряка) або на основі ортологічного гена, де послідовності зазначеного смислового сегмента та зазначеного антисмислового сегмента обидві містять нуклеотидний фрагмент, що має послідовність, щонайменше на 85 % ідентичну послідовності гена Р0 SEQ ID...

Спосіб індикації днк бактерії chlamydia pneumoniae у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 117492

Опубліковано: 26.06.2017

Автори: Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович, Корнієнко Марина Володимирівна

МПК: A61K 39/118

Мітки: pneumoniae, видової, фрагмента, ампліфікації, мембрани, реакції, полімеразній, спосіб, chlamydia, днк, індикації, момр, шляхом, бактерії, гена, ланцюговий, головного, білка, диференціації

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia рnеumoniae у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia рnеumoniae здійснюють за допомогою пари праймерів: прямого: ChPnMOMPL: 5'-GGAACAAAGTCTGCGACCAT-3' та зворотного: ChPnMOMPR: 5'-AAAGAAGGGTTCCATGCAGTT-3', з...

Спосіб прогнозування виникнення ішемічного атеротромботичного інсульту (іаті) з урахуванням поліморфізмів гена метилентетрагідрофолатредуктази (мтнfr)

Завантаження...

Номер патенту: 117453

Опубліковано: 26.06.2017

Автори: Матлай Ольга Іванівна, Снєгірьова Інна Олександрівна, Обухова Ольга Анатоліївна, Дубовик Євген Іванович, Гарбузова Вікторія Юріївна

МПК: G01N 33/50

Мітки: ішемічного, інсульту, урахуванням, поліморфізмів, спосіб, прогнозування, іаті, гена, метилентетрагідрофолатредуктази, атеротромботичного, мтнfr, виникнення

Формула / Реферат:

Спосіб прогнозування виникнення ішемічного атеротромботичного інсульту (ІATI) з урахуванням поліморфізмів гена метилентетрагідрофолатредуктази (MTHFR), що включає визначення С677Т поліморфізму гена MTHFR, який відрізняється тим, що додатково індивідуально визначають А1298С поліморфізм гена MTHFR і при наявності носійства мінорного алеля за двома поліморфізмами С677Т та А1298С гена MTHFR роблять висновок про зростання ризику розвитку...

Спосіб індикації днк бактерії chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117100

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: C12Q 1/68, C12R 1/01

Мітки: полімеразній, білка, спосіб, індикації, момp, бактерії, видової, головного, диференціації, гена, фрагмента, ланцюговий, реакції, pecorum, мембрани, ампліфікації, chlamydia, днк, шляхом

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia pecorum здійснюють за допомогою пари праймерів: прямого: ChPecMOMPL 5'-TCCAATACGCACAATCGAAA-3' та зворотного: ChPecMOMPR 5'-GTAAGACAACGCTGCACCAA-3', з одержанням...

Спосіб індикації днк бактерії chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117099

Опубліковано: 12.06.2017

Автори: Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна

МПК: C12R 1/01, C12Q 1/68

Мітки: ланцюговий, гена, видової, бактерії, мембрани, chlamydia, білка, полімеразній, спосіб, реакції, момp, головного, ампліфікації, диференціації, шляхом, індикації, днк, фрагмента

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia suis здійснюють за допомогою пари праймерів: прямого: ChSuMOMPL: 5'- TTCTTTGCAATGCTGCTGAA-3' та зворотного: ChSuMOMPR: 5'- ATCAAAGCTTGCTCGAGACC-3', з одержанням...

Спосіб індикації днк бактерії chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 117097

Опубліковано: 12.06.2017

Автори: Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович

МПК: C12R 1/01, C12Q 1/68

Мітки: головного, днк, спосіб, момр, ланцюговий, шляхом, фрагмента, диференціації, видової, полімеразній, chlamydia, індикації, реакції, мембрани, гена, ампліфікації, бактерії, psittaci, білка

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia psittaci здійснюють за допомогою пари праймерів: прямого: ChPsMOMPL: 5'-GCACTATGTGGGAAGGTGCT-3' та зворотного: ChPsMOMPR: 5'-CCATTTGCTTCTGGCTGATT-3', з одержанням...

Спосіб індикації днк бактерії chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117091

Опубліковано: 12.06.2017

Автори: Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович, Корнієнко Марина Володимирівна

МПК: C12R 1/01, C12Q 1/68

Мітки: головного, chlamydia, видової, ампліфікації, індикації, ланцюговий, спосіб, abortus, шляхом, гена, момp, мембрани, білка, реакції, полімеразній, днк, фрагмента, диференціації, бактерії

Формула / Реферат:

Спосіб індикації ДНК бактерій Chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР) для її видової диференціації, який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia abortus здійснюють за допомогою пари праймерів: прямого: ChAbMOMPL: 5'-GGATAGACCCAACATCGCTT-3' та зворотного: ChAbMOMPR:...

Спосіб визначення зиготності гена fad-2 каноли з використанням плр із детекцією за кінцевою точкою

Завантаження...

Номер патенту: 114302

Опубліковано: 25.05.2017

Автори: Елерт Зоє, Убаясена Ласанта Чандана, Чаннабасаварадхя Чандра Шекара А.

МПК: C12Q 1/68, C07H 21/04

Мітки: зиготності, плр, канолі, спосіб, гена, визначення, кінцевою, детекцією, використанням, fad-2, точкою

Формула / Реферат:

1. Спосіб визначення зиготності рослини каноли, яка включає ген fad-2, причому згідно зі згаданим способом:одержують зразок геномної ДНК із рослини каноли;гібридизують зразок геномної ДНК з першим праймером і другим праймером, причому перший праймер і другий праймер містять SEQ ID NO: 2 і SEQ ID NO: 3;піддають згаданий зразок умовам полімеразної ланцюгової реакції (ПЛР), при яких утворюється амплікон;надають...

Спосіб визначення зиготності гена fad3 в канолі

Завантаження...

Номер патенту: 114301

Опубліковано: 25.05.2017

Автори: Гупта Манджу, Чаннабасаварадхя Чандра Шекара А., Убаясена Ласанта Чандана, Елерт Зоє

МПК: C07H 21/04, C12Q 1/68

Мітки: канолі, зиготності, визначення, гена, спосіб

Формула / Реферат:

1. Спосіб визначення зиготності рослини каноли, що містить ген fad-3c, причому згідно зі згаданим способом:отримують зразок геномної ДНК з рослини каноли;гібридизують зразок геномної ДНК з першим праймером і другим праймером, де перший праймер і другий праймер містять SEQ ID NO: 2 і SEQ ID NO: 3; піддають згаданий зразок умовам полімеразної ланцюгової реакції (ПЛР), при яких утворюється амплікон;надають можливість...

Спосіб ідентифікації гена стійкості pіarg

Завантаження...

Номер патенту: 115650

Опубліковано: 25.04.2017

Автори: Файт Віктор Іванович, Солоденко Анжелла Євгенівна

МПК: C12P 19/30, A01H 1/00

Мітки: гена, стійкості, pіarg, ідентифікації, спосіб

Формула / Реферат:

Спосіб ідентифікації гена стійкості PlARG, що включає виявлення стійкого до несправжньої борошнистої роси зразка соняшнику, який відрізняється тим, що здійснюють за допомогою електрофоретичного аналізу продуктів ампліфікації ДНК за мікросателітним локусом ORS 1039 та ідентифікації гена PlARG в генотипі зразка, що аналізують, за наявності в спектрі ампліфікації фрагмента ДНК розміром 190 пар нуклеотидів.

Даун-регуляція експресії гена за допомогою штучних мікро-рнк

Завантаження...

Номер патенту: 113950

Опубліковано: 10.04.2017

Автор: МакГонігл Брайан

МПК: A01H 5/00, C12N 15/82

Мітки: даун-регуляція, мікро-рнк, штучних, допомогою, експресії, гена

Формула / Реферат:

1. Виділений фрагмент нуклеїнової кислоти, що включає дезоксирибонуклеотидну послідовність, як описано в SEQ ID NO: 15, де (і) нуклеотиди 83-103 у SEQ ID NO: 15 заміщені першою мінливою нуклеотидною субпослідовністю, розмір якої варіює від 19 до 24 нуклеотидів залежно від мішеневої послідовності, чия експресія підлягає зниженню, (іі) нуклеотиди 172-192 у SEQ ID NO: 15 заміщені другою мінливою нуклеотидною субпослідовністю, розмір якої варіює...

Даун-регуляція експресії гена за допомогою штучних мікро-рнк

Завантаження...

Номер патенту: 113949

Опубліковано: 10.04.2017

Автор: МакГонігл Брайан

МПК: C12N 15/82, A01H 5/00

Мітки: експресії, гена, даун-регуляція, мікро-рнк, допомогою, штучних

Формула / Реферат:

1. Виділений фрагмент нуклеїнової кислоти, що включає дезоксирибонуклеотидну послідовність, як описано в SEQ ID NO:13, де (і) нуклеотиди 53-73 у SEQ ID NO:13 заміщені першою мінливою нуклеотидною субпослідовністю, розмір якої варіює від 19 до 24 нуклеотидів залежно від мішеневої послідовності, чия експресія підлягає зниженню, (іі) нуклеотиди 97-117 у SEQ ID NO:13 заміщені другою мінливою нуклеотидною субпослідовністю, розмір якої варіює від...

Даун-регуляція експресії гена за допомогою штучних мікро-рнк

Завантаження...

Номер патенту: 113948

Опубліковано: 10.04.2017

Автор: МакГонігл Брайан

МПК: A01H 5/00, C12N 15/82

Мітки: експресії, мікро-рнк, штучних, гена, допомогою, даун-регуляція

Формула / Реферат:

1. Виділений фрагмент нуклеїнової кислоти, що включає дезоксирибонуклеотидну послідовність, як описано в SEQ ID NO: 14, де (і) нуклеотиди 110-130 у SEQ ID NO: 14 заміщені першою мінливою нуклеотидною субпослідовністю, розмір якої варіює від 19 до 24 нуклеотидів залежно від мішеневої послідовності, чия експресія підлягає зниженню, (іі) нуклеотиди 184-203 у SEQ ID NO: 14 заміщені другою мінливою нуклеотидною субпослідовністю, розмір якої...

Спосіб прогнозування перебігу панкреатиту за поліморфізмом гена il-4 (c-590т)

Завантаження...

Номер патенту: 114383

Опубліковано: 10.03.2017

Автор: Іващук Сергій Іванович

МПК: G01N 33/50

Мітки: прогнозування, панкреатиту, гена, поліморфізмом, перебігу, спосіб, c-590т

Формула / Реферат:

Спосіб прогнозування перебігу панкреатиту за поліморфізмом гена IL-4 (С-590Т) шляхом визначення поліморфізму певного кандидатного гена з використанням полімеразної ланцюгової реакції, який відрізняється тим, що визначають поліморфізм С-590Т гена інтерлейкіну 4 IL-4, використовують як показник лабораторного контролю клінічного перебігу панкреатиту рівень активності печінкових ферментів аланінамінотрансферази та аспартатамінотрансферази та...

Спосіб прогнозування перебігу панкреатиту за поліморфізмом гена cftr (delf508)

Завантаження...

Номер патенту: 114303

Опубліковано: 10.03.2017

Автори: Сидорчук Лариса Петрівна, Іващук Сергій Іванович

МПК: G01N 33/50

Мітки: поліморфізмом, панкреатиту, delf508, гена, перебігу, спосіб, прогнозування

Формула / Реферат:

Спосіб прогнозування перебігу панкреатиту за поліморфізмом гена CFTR (delF508) шляхом визначення поліморфізму певного кандидатного гена з використанням полімеразної ланцюгової реакції, який відрізняється тим, що визначають поліморфізм delF508 гена трансмембранного регуляторного білка муковісцидозу CFTR, використовують як показник лабораторного контролю клінічного перебігу панкреатиту рівень тригліцеридів крові хворого; наявність NN-генотипу...

Спосіб визначення мутацій гена notch1

Завантаження...

Номер патенту: 112949

Опубліковано: 10.01.2017

Автори: Білоус Надія Іванівна, Абраменко Ірина Вікторівна, Чумак Анатолій Андрійович

МПК: C12Q 1/68

Мітки: notch1, гена, спосіб, визначення, мутацій

Формула / Реферат:

Спосіб визначення мутацій гена NOTCH1, що включає отримання генетичного матеріалу з клітин периферичної крові, ампліфікацію фрагмента гена в ділянці мутації у присутності барвника SYBR green в режимі реального часу та оцінку рівня ампліфікації порівняно з контрольним геном b-мікроглобуліну (В2М) за значенням порогового дельта циклу (DСТ) і характеристиками кривої плавлення, який відрізняється тим, що порівнюється рівень експресії мутованого...

Спосіб оцінки впливу поліморфізмів м235т гена agt на ефективність диференційованої профілактики та лікування хворих з цукровим діабетом 2 типу і артеріальною гіпертензією за понятовською т.ю.

Завантаження...

Номер патенту: 112939

Опубліковано: 10.11.2016

Автор: Понятовська Тетяна Юріївна

МПК: A61B 10/00

Мітки: гіпертензією, оцінки, спосіб, диференційованої, цукровим, лікування, діабетом, впливу, хворих, ефективність, гена, артеріальною, поліморфізмів, м235т, т.ю, профілактики, типу, понятовською

Формула / Реферат:

Спосіб оцінки впливу поліморфізмів М235Т гена AGT на ефективність диференційованої профілактики і лікування хворих з цукровим діабетом 2 типу та артеріальною гіпертензією шляхом визначення поліморфізмів гена AGT, який відрізняється тим, що досліджують наявність поліморфізмів гена AGT методом піросеквенування і при визначенні гомозиготного генотипу визначають як більш ефективний нефропротекторний блокатор ангіотензин-1...

Спосіб отримання інтерлейкіну-7 людини за допомогою рекомбінантної молекули, рекомбінантна молекула, що містить кднкову копію структурної частини сплайсованого кднк гена інтерлейкіну-7 людини та експресійного в

Завантаження...

Номер патенту: 112442

Опубліковано: 12.09.2016

Автор: ТОВАРИСТВО З ОБМЕЖЕНОЮ ВІДПОВІДАЛЬНІСТЮ "УНІВЕРСАЛЬНЕ АГЕНТСТВО "ПРО-ФАРМА"

МПК: C07K 14/54, C07K 17/02, C12N 1/21 ...

Мітки: людини, сплайсованого, інтерлейкіну-7, містить, молекули, молекула, рекомбінантна, кднкову, структурної, копію, експресійного, гена, спосіб, кднк, частини, отримання, рекомбінантної, допомогою

Формула / Реферат:

1. Спосіб отримання біологічно активної форми інтерлейкіну-7 людини за допомогою рекомбінантної молекули, що містить кДНКову копію структурної частини сплайсованого кДНК гена інтерлейкіну-7 людини та необхідні службові послідовності, причому рекомбінантну молекулу вбудовують в плазміду pACYC_IL7s, яка позначена на Фіг. 2, і вводять в бактерію E. coli BL21(DE3), де ДНК-послідовність кДНКової копії на 100 % співпадає з відповідними...

Спосіб діагностики розвитку та прогресування хронічної серцевої недостатності у хворих на ішемічну хворобу серця, поєднану з ожирінням, за поліморфізмом гена ендотеліальної синтази оксиду азоту

Завантаження...

Номер патенту: 108077

Опубліковано: 24.06.2016

Автори: Кадикова Ольга Ігорівна, Кравчун Павло Григорович

МПК: G01N 33/48

Мітки: гена, хворобу, хворих, хронічної, поєднану, ожирінням, оксиду, азоту, серця, серцевої, ендотеліальної, спосіб, синтази, ішемічну, розвитку, прогресування, недостатності, поліморфізмом, діагностики

Формула / Реферат:

Спосіб діагностики розвитку та прогресування хронічної серцевої недостатності, що включає оцінку вимірів загальноклінічних та інструментальних обстежень, який відрізняється тим, що у хворих з поєднаним перебігом ішемічної хвороби серця та ожиріння додатково оцінюють поліморфізм гена ендотеліальної синтази оксиду азоту (eNOS) і при наявності G алеля та G/G генотипу поліморфізму гена ендотеліальної синтази оксиду азоту (Glu298Asp) діагностують...

Спосіб прогнозування активності цитологічного синдрому у хворих на неалкогольну жирову хворобу печінки з урахуванням поліморфізму гена глутатіон-s-трансферази

Завантаження...

Номер патенту: 105909

Опубліковано: 11.04.2016

Автори: Присяжнюк Василь Петрович, Сидорчук Лариса Петрівна

МПК: A61P 1/16, A61K 35/407

Мітки: поліморфізму, спосіб, урахуванням, прогнозування, гена, цитологічного, жирову, хворих, глутатіон-s-трансферази, печінки, хворобу, активності, неалкогольну, синдрому

Формула / Реферат:

Спосіб прогнозування активності цитолітичного синдрому у хворих на неалкогольну жирову хворобу печінки з урахуванням поліморфізму гена глутатіон-S-трансферази шляхом проведення комплексного діагностичного дослідження та визначення показників ліпідного профілю, який відрізняється тим, що додатково досліджують A313G поліморфізм гена GSTP1 з метою визначення G-алеля зазначеного гена і при його виявленні прогнозують ймовірно вищу активність...

Спосіб визначення днк бактерій виду chlamydia abortus, chlamydia pecorum, chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу р (rnase p rna)

Завантаження...

Номер патенту: 110546

Опубліковано: 12.01.2016

Автори: Цівенко Тетяна Михайлівна, Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: C12Q 1/68, C12R 1/01

Мітки: шляхом, ампліфікації, спосіб, chlamydia, pecorum, ендорибонуклеазу, rnase, реакції, ланцюговий, кодує, виду, полімеразній, фрагмента, бактерій, гена, abortus, визначення, psittaci, днк

Формула / Реферат:

Спосіб визначення ДНК бактерій виду Chlamydia abortus, Chlamydia pecorum, Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу Р (RNase Р RNA), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки фрагмента гена RNase Р RNA здійснюють за допомогою пари праймерів: прямого:CHCPF:5`-GGAGAAACTCCAGGGGCCGT-3` та зворотного:...

Спосіб оцінки впливу поліморфізмів м235т гена agt на ефективність диференційованої профілактики та лікування хворих з цукровим діабетом 2 типу і артеріальною гіпертензією за понятовською т.ю.

Завантаження...

Номер патенту: 103751

Опубліковано: 25.12.2015

Автор: Понятовська Тетяна Юріївна

МПК: A61B 10/00

Мітки: гена, ефективність, оцінки, діабетом, т.ю, типу, артеріальною, диференційованої, хворих, м235т, впливу, цукровим, гіпертензією, спосіб, поліморфізмів, профілактики, лікування, понятовською

Формула / Реферат:

Спосіб оцінки впливу поліморфізмів М235Т гена AGT на ефективність диференційованої профілактики і лікування хворих з цукровим діабетом 2 типу та артеріальною гіпертензією шляхом визначення поліморфізмів гена АПФ, який відрізняється тим, що досліджують наявність поліморфізмів гена AGT методом піросеквенування і при визначенні гомозиготного генотипу визначають як більш ефективний нефропротекторний блокатор ангіотензин-1 (Лозартран).

Спосіб визначення днк бактерій chlamydia felis у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр)

Завантаження...

Номер патенту: 109489

Опубліковано: 25.08.2015

Автори: Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович, Цівенко Тетяна Михайлівна

МПК: C12Q 1/68, C12R 1/01

Мітки: бактерій, ланцюговий, днк, білка, felis, ампліфікації, шляхом, момр, головного, визначення, мембрани, спосіб, фрагменту, гена, реакції, chlamydia, полімеразній

Формула / Реферат:

Спосіб визначення ДНК збудника хламідійних інфекцій домашніх котів у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки ДНК МОМР бактерії Chlamydia felis здійснюють з використанням пари праймерів: прямого CHFMF 5'-GCAGCTTCTGGAACTGCAAGC-3' та зворотного CHFMR 5'-GGCGАААТСAGTTCCTGCAAGА-3' з одержанням...

Застосування гена регулювання висоти рослин

Завантаження...

Номер патенту: 109249

Опубліковано: 10.08.2015

Автори: Лі Цюнь, Хі Зухуа, Жанг Іньінь

МПК: A01H 5/00, C12N 15/29, C07K 14/415 ...

Мітки: гена, регулювання, застосування, висоті, рослин

Формула / Реферат:

1. Застосування поліпептиду регулювання висоти рослини, або полінуклеотиду, що кодує поліпептид регулювання висоти рослини, у покращенні агрономічних характеристик рослини шляхом регулювання висоти рослини, розміру, кущіння, врожайності, розміру квіткового органа або розміру насіння рослини, де поліпептид регулювання висоти рослини вибраний з групи, яка включає:(a) поліпептид, що має амінокислотну послідовність, викладену у SEQ ID NO:...

Спосіб збільшення виходу насіння рослини шляхом руйнування гена ahp6

Завантаження...

Номер патенту: 109040

Опубліковано: 10.07.2015

Автори: Шмюллінг Томас, Вернер Томас

МПК: A01H 5/04, C07K 14/415, A01H 5/00 ...

Мітки: збільшення, виходу, рослини, руйнування, шляхом, насіння, гена, спосіб

Формула / Реферат:

1. Спосіб збільшення виходу насіння рослини, що включає руйнування ендогенного гена AHP6 у клітинах рослини, при цьому дане руйнування пригнічує експресію й (або) активність продукту вищезгаданого ендогенного гена AHP6 у порівнянні з відповідною контрольною рослиною, у відповідному гені якої немає зазначеного руйнування, причому ендогенний ген AHP6 включає або складається з: (а) нуклеїнової кислоти, що кодує білок AHP6 і включає...

Спосіб корекції ендотеліальної дисфункції при неалкогольному стеатогепатиті, поєднаному з хронічним обструктивним захворюванням легень залежно від поліморфізму гена

Завантаження...

Номер патенту: 94389

Опубліковано: 10.11.2014

Автори: Ступницька Ганна Ярославівна, Цинтар Тетяна Петрівна, Федів Олександр Іванович

МПК: G01N 33/48

Мітки: стеатогепатиті, поліморфізму, корекції, обструктивним, поєднаному, неалкогольному, залежно, гена, ендотеліальної, хронічним, легень, дисфункції, захворюванням, спосіб

Формула / Реферат:

Спосіб корекції ендотеліальної дисфункції при неалкогольному стеатогепатиті, поєднаному із хронічним обструктивним захворюванням легень шляхом призначення L-аргініну (тівортіну), який відрізняється тим, що тівортін призначають залежно від рівня нітритів/нітратів в крові та поліморфізму гена T894G ендотеліальної NO-синтази: при нормальній концентрації нітритів/нітратів або при їх незначному зростанні та за наявності генотипу 894GG 4,2 %...

Спосіб визначення однонуклеотидних поліморфізмів гена матриксної металопротеїнази 20

Завантаження...

Номер патенту: 93849

Опубліковано: 27.10.2014

Автори: Кайдашев Ігор Петрович, Ткаченко Ірина Михайлівна, Шликова Оксана Анатоліївна, Труфанова Валентина Петрівна, Весніна Людмила Едуардівна

МПК: A61B 5/00, G01N 1/00

Мітки: спосіб, поліморфізмів, гена, матриксної, визначення, однонуклеотидних, металопротеїнази

Формула / Реферат:

Спосіб визначення однонуклеотидних поліморфізмів гена матриксної металопротеїнази 20, який включає молекулярно-біологічний метод одночасного виявлення наявності "дикої" та мутантної алелі гена за допомогою полімеразної ланцюгової реакції в режимі реального часу, який відрізняється тим, що врахування результатів ведуть з аналізом кривих плавлення ДНК дуплексів та флуоресцентною реєстрацією накопичення ДНК за флуоресцентними...

Порушення гена ckx3 та принаймні одного іншого гена ckx у рослині або рослинній клітині, що приводить до поліпшених ознак

Завантаження...

Номер патенту: 106621

Опубліковано: 25.09.2014

Автори: Шмюллінг Томас, Вернер Томаш, Бартріна і Маннс Ізабель

МПК: C12N 15/82

Мітки: гена, поліпшених, одного, порушення, приводить, іншого, рослини, ознак, рослинній, принаймні, клітині

Формула / Реферат:

1. Ізольована рослинна клітина, що включає порушення принаймні у:і) ендогенному СКХ3 гені, який кодує цитокініноксидазу/дегідрогеназу, що включає поліпептидну послідовність, яка є ідентичною або має принаймні 95 % ідентичності з SEQ ID NО: 1 або її ортологом;таіі) одному додатковому ендогенному гені, що кодує цитокініноксидазу/дегідрогеназу та є відмінним від гена, який є визначеним у і);де вказані порушення...

Спосіб прогнозування нейросенсорної приглухуватості у дітей залежно від генотипу гена конексину (сх26) бета 2

Завантаження...

Номер патенту: 90488

Опубліковано: 26.05.2014

Автори: Іфтода Оксана Миколаївна, Кушнір Оксана Василівна, Сидорчук Лариса Петрівна

МПК: A61B 5/0488, A61B 5/12

Мітки: бета, гена, конексину, нейросенсорної, залежно, прогнозування, генотипу, приглухуватості, дітей, сх26, спосіб

Формула / Реферат:

Спосіб прогнозування нейросенсорної приглухуватості у дітей залежно від генотипу гена конексину (Сх26) бета 2 шляхом визначення даних комп'ютерної аудіометрії, який відрізняється тим, що додатково виконують імпедансометрію, тимпанометрію і аналізують алельний стан гена GJB2 (rs 121011), причому носіїв гомозиготної "мутації" 35delG гена GJB2 відносять до груп із високою прогностичною цінністю позитивного результату появи тяжких форм...

Спосіб визначення ампліфікації гена mycn у дітей, хворих на нейробластому

Завантаження...

Номер патенту: 86355

Опубліковано: 25.12.2013

Автори: Климнюк Григорій Іванович, Павлик Сергій Володимирович, Храновська Наталя Миколаївна, Свергун Наталія Миколаївна, Шайда Елена Вікторівна, Скачкова Оксана Володимирівна, Іонкіна Наталія Валеріївна

МПК: G01N 33/00, A61B 10/00

Мітки: хворих, спосіб, ампліфікації, гена, нейробластому, дітей, визначення

Формула / Реферат:

Спосіб визначення ампліфікації гена MYCN у дітей, хворих на нейробластому, що включає дослідження методом полімеразно-ланцюгової реакції з використанням специфічних праймерів, який відрізняється тим, що полімеразно-ланцюгову реакцію проводять з використанням специфічних TaqMan-зондів MGB-типу з детекцією результатів в режимі реального часу та при виявлені в пухлинній клітині ампліфікацію гена MYCN більше 10 копій, прогнозують несприятливий...

Спосіб визначення однонуклеотидного поліморфізму g28197a>g гена еластину методом алель-специфічної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 85434

Опубліковано: 25.11.2013

Автори: Весніна Людмила Едуардівна, Воровський Олег Олегович, Скрипник Володимир Михайлович, Шликова Оксана Анатоліївна, Аветіков Давид Соломонович, Кайдашев Ігор Петрович

МПК: A61B 5/00, G01N 1/00

Мітки: полімеразної, алель-специфічної, методом, реакції, еластину, однонуклеотидного, гена, визначення, спосіб, ланцюгової, поліморфізму, g28197a>g

Формула / Реферат:

Спосіб визначення однонуклеотидного поліморфізму g28197A>G гена еластину методом алель-специфічної полімеразної ланцюгової реакції, що включає визначення наявності поліморфних алелей А та G, який відрізняється тим, що одночасно виявляється наявність "дикої" та мутантної алелі за допомогою полімеразної ланцюгової реакції з парою алель-специфічних праймерів та парою специфічних проб, мічених флуоресцентними барвниками FAM і R6G з...