Патенти з міткою «гена»

Спосіб визначення мутацій гена notch1 у 3’utr некодуючому регіоні гена

Завантаження...

Номер патенту: 123082

Опубліковано: 12.02.2018

Автори: Чумак Анатолій Андрійович, Абраменко Ірина Вікторівна, Білоус Надія Іванівна

МПК: A61B 10/00, G01N 33/00

Мітки: notch1, 3'utr, гена, визначення, некодуючому, регіони, спосіб, мутацій

Формула / Реферат:

Спосіб визначення мутацій гена NOTCH 1 у 3'UTR некодуючому регіоні, що включає отримання генетичного матеріалу з клітин периферичної крові та проведення полімеразної ланцюгової реакції (ПЛР) з наступною рестрикцією отриманих продуктів реакції рестриктазою PfeI (TfiI), який відрізняється тим, що проведення ампліфікації відбувається з набором оригінальних праймерів (прямий праймер: CCGACCAGAGGAGCCTTTT; зворотний праймер: TAACAGGCAGGTGATGCTG),...

Спосіб індикації днк бактерії chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 123070

Опубліковано: 12.02.2018

Автори: Ксьонз Ігор Миколайович, Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович

МПК: A61K 39/118, C12R 1/01, C12Q 1/68 ...

Мітки: диференціації, шляхом, ланцюговий, момр, днк, бактерії, полімеразній, avium, реакції, фрагменту, білка, мембрани, головного, спосіб, видової, гена, chlamydia, ампліфікації, індикації

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia avium здійснюють за допомогою пари праймерів: прямого: ChAvMOMPL: 5' - TTCTGGTGATCCTTGCGACC-3' та зворотного: ChAvMOMPR: 5'- GCTCCTAAAGTTGCACAACC - 3', з одержанням...

Спосіб діагностики артеріальної гіпертензії в поєднанні з неалкогольною жировою хворобою печінки з поліморфізмом гена рецептора ангіотензину іі першого типу

Завантаження...

Номер патенту: 121299

Опубліковано: 27.11.2017

Автори: Зайцева Маріанна Михайлівна, Бабак Олег Якович

МПК: G01N 33/50, G01N 33/00

Мітки: гена, діагностики, жировою, поєднанні, хворобою, артеріальної, гіпертензії, ангіотензину, спосіб, печінки, рецептора, поліморфізмом, типу, неалкогольною, першого

Формула / Реферат:

Спосіб діагностики артеріальної гіпертензії у хворих із супутньою неалкогольною жировою хворобою печінки, який включає оцінку вимірів загально клінічних та інструментальних обстежень, який відрізняється тим, що для діагностики артеріальної гіпертензії в поєднанні з неалкогольною жировою хворобою печінки у хворого додатково оцінюють поліморфізм гена рецептора ангіотензину II першого типу (А1166С) та при наявності А/С генотипу діагностують...

Спосіб діагностики та прогнозування перебігу ревматоїдного артриту в поєднанні з абдомінальним ожирінням, артеріальною гіпертензією та цукровим діабетом типу 2 з урахуванням поліморфізму гена

Завантаження...

Номер патенту: 120866

Опубліковано: 27.11.2017

Автори: Федів Олександр Іванович, Сидорчук Лариса Петрівна, Букач Ольга Петрівна

МПК: G01N 33/50

Мітки: спосіб, перебігу, ожирінням, гена, артеріальною, гіпертензією, діабетом, урахуванням, типу, абдомінальним, поєднанні, діагностики, ревматоїдного, цукровим, поліморфізму, прогнозування, артриту

Формула / Реферат:

Спосіб діагностики та прогнозування перебігу ревматоїдного артриту в поєднанні з абдомінальним ожирінням, артеріальною гіпертензією та цукровим діабетом типу 2 з урахуванням поліморфізму гена шляхом визначення клінічних, біохімічних, гострофазових показників, визначення антитіл до циклічного цитрулінованого пептиду та ліпідного профілю, який відрізняється тим, що додатково визначають поліморфізм гена Т-786С eNOS; і при виявленні його...

Спосіб лікування ревматоїдного артриту в поєднанні з абдомінальним ожирінням, артеріальною гіпертензією та цукровим діабетом типу 2 та поліморфізмом гена t-786c enos

Завантаження...

Номер патенту: 120255

Опубліковано: 25.10.2017

Автори: Букач Ольга Петрівна, Сидорчук Лариса Петрівна, Федів Олександр Іванович

МПК: A61K 31/00, A61K 38/00

Мітки: типу, ревматоїдного, гіпертензією, абдомінальним, гена, артриту, артеріальною, лікування, цукровим, поєднанні, спосіб, t-786c, ожирінням, поліморфізмом, діабетом

Формула / Реферат:

Спосіб лікування ревматоїдного артриту в поєднанні з абдомінальним ожирінням, артеріальною гіпертензією, цукровим діабетом типу 2 та поліморфізмом гена Т-786С eNOS СС-генотипу шляхом призначення базисної терапії, в основі якої лежить застосування метотрексату, який відрізняється тим, що додатково призначають блокатор рецепторів AT II у дозі 80 мг 1 раз на добу зранку, статин у дозі 20 мг 1 раз на добу ввечері та L-аргінін 15 мл по 1 мірній...

Спосіб боротьби з грибами та ооміцетами шляхом інгібування гена сахаропіндегідрогенази

Завантаження...

Номер патенту: 115132

Опубліковано: 25.09.2017

Автори: Ессігманн Бернд, Вілалба Француа, Паже Ерік, Делебарре Томас, Шмітт Фредерік, Дорме Сесіль

МПК: A01H 5/00, C12N 15/113, C12N 15/82 ...

Мітки: інгібування, шляхом, ооміцетами, спосіб, гена, грибами, боротьби, сахаропіндегідрогенази

Формула / Реферат:

1. Молекула длРНК, яка містить і) перший ланцюг, що містить послідовність, щонайменше на 95 % ідентичну до щонайменше 18 суміжних нуклеотидів гена сахаропіндегідрогенази гриба або ооміцета, та іі) другий ланцюг, що містить послідовність, комплементарну до понад щонайменше 80 % нуклеотидів першого ланцюга, де ген гриба або ооміцета вибирають із групи, що складається з:a) полінуклеотиду, що містить послідовність, вказану у SEQ ID NO: 1,...

Спосіб лікування загрозливого аборту у жінок залежно від поліморфізму гена рецептора прогестерону rs590688

Завантаження...

Номер патенту: 118305

Опубліковано: 25.07.2017

Автор: Кривопустов Олександр Сергійович

МПК: C12N 15/00, A61K 31/00

Мітки: аборту, рецептора, гена, прогестерону, rs590688, загрозливого, поліморфізму, жінок, спосіб, залежно, лікування

Формула / Реферат:

Спосіб лікування загрозливого аборту у жінок залежно від поліморфізму гена рецептора прогестерону rs590688, що включає призначення натурального мікронізованого прогестерону, який відрізняється тим, що натуральний мікронізований прогестерон призначають в дозі 100 мг 3 рази на добу перорально при наявності у жінки гетерозиготи CG або мінорної гомозиготи GG та в дозі 200 мг 3 рази на добу перорально при наявності мажорної гомозиготи СС.

Спосіб прогнозування розвитку загрозливого аборту у жінок з урахуванням поліморфізму гена прогесторонового рецептора

Завантаження...

Номер патенту: 118250

Опубліковано: 25.07.2017

Автор: Кривопустов Олександр Сергійович

МПК: A61B 5/00, C12N 15/00

Мітки: рецептора, прогесторонового, поліморфізму, гена, загрозливого, прогнозування, жінок, спосіб, аборту, урахуванням, розвитку

Формула / Реферат:

Спосіб прогнозування розвитку загрозливого аборту у жінок з урахуванням поліморфізму гена прогестеронового рецептора, який відрізняється тим, що включає визначення рівня сприйняття стресу за шкалою Perceived Stress Scale (PSS) та алельного варіанта за поліморфізмом гена рецептора прогестерону rs 590688 методом полімеразної ланцюгової реакції, за якими розраховують ймовірність розвитку загрозливого аборту "р" за...

Конструкція для сайленсингу гена p0 та її застосування

Завантаження...

Номер патенту: 114603

Опубліковано: 10.07.2017

Автори: Веєн Гай, Граф Веронік, Бро Веронік, Жільмер Давід, Люфевр Марк, Кляйн Елоді

МПК: C12N 15/82

Мітки: гена, конструкція, сайленсингу, застосування

Формула / Реферат:

1. Конструкція РНК, що містить послідовність смислового сегмента і послідовність антисмислового сегмента, які мають послідовності, одержані на основі гена Р0 геному BMYV (вірус слабкого пожовтіння буряка) або на основі ортологічного гена, де послідовності зазначеного смислового сегмента та зазначеного антисмислового сегмента обидві містять нуклеотидний фрагмент, що має послідовність, щонайменше на 85 % ідентичну послідовності гена Р0 SEQ ID...

Спосіб індикації днк бактерії chlamydia pneumoniae у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 117492

Опубліковано: 26.06.2017

Автори: Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна

МПК: A61K 39/118

Мітки: днк, полімеразній, ланцюговий, бактерії, мембрани, головного, момр, гена, індикації, видової, ампліфікації, pneumoniae, спосіб, шляхом, білка, реакції, диференціації, chlamydia, фрагмента

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia рnеumoniae у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia рnеumoniae здійснюють за допомогою пари праймерів: прямого: ChPnMOMPL: 5'-GGAACAAAGTCTGCGACCAT-3' та зворотного: ChPnMOMPR: 5'-AAAGAAGGGTTCCATGCAGTT-3', з...

Спосіб прогнозування виникнення ішемічного атеротромботичного інсульту (іаті) з урахуванням поліморфізмів гена метилентетрагідрофолатредуктази (мтнfr)

Завантаження...

Номер патенту: 117453

Опубліковано: 26.06.2017

Автори: Матлай Ольга Іванівна, Снєгірьова Інна Олександрівна, Дубовик Євген Іванович, Обухова Ольга Анатоліївна, Гарбузова Вікторія Юріївна

МПК: G01N 33/50

Мітки: атеротромботичного, ішемічного, іаті, гена, спосіб, мтнfr, поліморфізмів, метилентетрагідрофолатредуктази, урахуванням, інсульту, виникнення, прогнозування

Формула / Реферат:

Спосіб прогнозування виникнення ішемічного атеротромботичного інсульту (ІATI) з урахуванням поліморфізмів гена метилентетрагідрофолатредуктази (MTHFR), що включає визначення С677Т поліморфізму гена MTHFR, який відрізняється тим, що додатково індивідуально визначають А1298С поліморфізм гена MTHFR і при наявності носійства мінорного алеля за двома поліморфізмами С677Т та А1298С гена MTHFR роблять висновок про зростання ризику розвитку...

Спосіб індикації днк бактерії chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117100

Опубліковано: 12.06.2017

Автори: Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович, Корнієнко Марина Володимирівна

МПК: C12Q 1/68, C12R 1/01

Мітки: полімеразній, бактерії, ампліфікації, фрагмента, головного, шляхом, мембрани, диференціації, гена, спосіб, реакції, ланцюговий, момp, днк, chlamydia, індикації, pecorum, видової, білка

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia pecorum здійснюють за допомогою пари праймерів: прямого: ChPecMOMPL 5'-TCCAATACGCACAATCGAAA-3' та зворотного: ChPecMOMPR 5'-GTAAGACAACGCTGCACCAA-3', з одержанням...

Спосіб індикації днк бактерії chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117099

Опубліковано: 12.06.2017

Автори: Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна

МПК: C12Q 1/68, C12R 1/01

Мітки: головного, момp, видової, білка, днк, диференціації, ампліфікації, індикації, реакції, ланцюговий, фрагмента, шляхом, бактерії, chlamydia, спосіб, полімеразній, мембрани, гена

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia suis здійснюють за допомогою пари праймерів: прямого: ChSuMOMPL: 5'- TTCTTTGCAATGCTGCTGAA-3' та зворотного: ChSuMOMPR: 5'- ATCAAAGCTTGCTCGAGACC-3', з одержанням...

Спосіб індикації днк бактерії chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 117097

Опубліковано: 12.06.2017

Автори: Ксьонз Ігор Миколайович, Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович

МПК: C12R 1/01, C12Q 1/68

Мітки: білка, шляхом, спосіб, psittaci, гена, індикації, видової, полімеразній, реакції, бактерії, фрагмента, chlamydia, ампліфікації, мембрани, момр, днк, диференціації, головного, ланцюговий

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia psittaci здійснюють за допомогою пари праймерів: прямого: ChPsMOMPL: 5'-GCACTATGTGGGAAGGTGCT-3' та зворотного: ChPsMOMPR: 5'-CCATTTGCTTCTGGCTGATT-3', з одержанням...

Спосіб індикації днк бактерії chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117091

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: C12Q 1/68, C12R 1/01

Мітки: полімеразній, головного, мембрани, диференціації, ланцюговий, спосіб, білка, реакції, chlamydia, момp, днк, шляхом, індикації, фрагмента, видової, ампліфікації, бактерії, abortus, гена

Формула / Реферат:

Спосіб індикації ДНК бактерій Chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР) для її видової диференціації, який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia abortus здійснюють за допомогою пари праймерів: прямого: ChAbMOMPL: 5'-GGATAGACCCAACATCGCTT-3' та зворотного: ChAbMOMPR:...

Спосіб визначення зиготності гена fad-2 каноли з використанням плр із детекцією за кінцевою точкою

Завантаження...

Номер патенту: 114302

Опубліковано: 25.05.2017

Автори: Елерт Зоє, Убаясена Ласанта Чандана, Чаннабасаварадхя Чандра Шекара А.

МПК: C07H 21/04, C12Q 1/68

Мітки: спосіб, кінцевою, точкою, плр, канолі, гена, визначення, fad-2, зиготності, використанням, детекцією

Формула / Реферат:

1. Спосіб визначення зиготності рослини каноли, яка включає ген fad-2, причому згідно зі згаданим способом:одержують зразок геномної ДНК із рослини каноли;гібридизують зразок геномної ДНК з першим праймером і другим праймером, причому перший праймер і другий праймер містять SEQ ID NO: 2 і SEQ ID NO: 3;піддають згаданий зразок умовам полімеразної ланцюгової реакції (ПЛР), при яких утворюється амплікон;надають...

Спосіб визначення зиготності гена fad3 в канолі

Завантаження...

Номер патенту: 114301

Опубліковано: 25.05.2017

Автори: Гупта Манджу, Елерт Зоє, Убаясена Ласанта Чандана, Чаннабасаварадхя Чандра Шекара А.

МПК: C07H 21/04, C12Q 1/68

Мітки: визначення, канолі, зиготності, гена, спосіб

Формула / Реферат:

1. Спосіб визначення зиготності рослини каноли, що містить ген fad-3c, причому згідно зі згаданим способом:отримують зразок геномної ДНК з рослини каноли;гібридизують зразок геномної ДНК з першим праймером і другим праймером, де перший праймер і другий праймер містять SEQ ID NO: 2 і SEQ ID NO: 3; піддають згаданий зразок умовам полімеразної ланцюгової реакції (ПЛР), при яких утворюється амплікон;надають можливість...

Спосіб ідентифікації гена стійкості pіarg

Завантаження...

Номер патенту: 115650

Опубліковано: 25.04.2017

Автори: Солоденко Анжелла Євгенівна, Файт Віктор Іванович

МПК: C12P 19/30, A01H 1/00

Мітки: стійкості, ідентифікації, гена, спосіб, pіarg

Формула / Реферат:

Спосіб ідентифікації гена стійкості PlARG, що включає виявлення стійкого до несправжньої борошнистої роси зразка соняшнику, який відрізняється тим, що здійснюють за допомогою електрофоретичного аналізу продуктів ампліфікації ДНК за мікросателітним локусом ORS 1039 та ідентифікації гена PlARG в генотипі зразка, що аналізують, за наявності в спектрі ампліфікації фрагмента ДНК розміром 190 пар нуклеотидів.

Даун-регуляція експресії гена за допомогою штучних мікро-рнк

Завантаження...

Номер патенту: 113950

Опубліковано: 10.04.2017

Автор: МакГонігл Брайан

МПК: A01H 5/00, C12N 15/82

Мітки: даун-регуляція, експресії, мікро-рнк, штучних, допомогою, гена

Формула / Реферат:

1. Виділений фрагмент нуклеїнової кислоти, що включає дезоксирибонуклеотидну послідовність, як описано в SEQ ID NO: 15, де (і) нуклеотиди 83-103 у SEQ ID NO: 15 заміщені першою мінливою нуклеотидною субпослідовністю, розмір якої варіює від 19 до 24 нуклеотидів залежно від мішеневої послідовності, чия експресія підлягає зниженню, (іі) нуклеотиди 172-192 у SEQ ID NO: 15 заміщені другою мінливою нуклеотидною субпослідовністю, розмір якої варіює...

Даун-регуляція експресії гена за допомогою штучних мікро-рнк

Завантаження...

Номер патенту: 113949

Опубліковано: 10.04.2017

Автор: МакГонігл Брайан

МПК: C12N 15/82, A01H 5/00

Мітки: експресії, допомогою, штучних, даун-регуляція, мікро-рнк, гена

Формула / Реферат:

1. Виділений фрагмент нуклеїнової кислоти, що включає дезоксирибонуклеотидну послідовність, як описано в SEQ ID NO:13, де (і) нуклеотиди 53-73 у SEQ ID NO:13 заміщені першою мінливою нуклеотидною субпослідовністю, розмір якої варіює від 19 до 24 нуклеотидів залежно від мішеневої послідовності, чия експресія підлягає зниженню, (іі) нуклеотиди 97-117 у SEQ ID NO:13 заміщені другою мінливою нуклеотидною субпослідовністю, розмір якої варіює від...

Даун-регуляція експресії гена за допомогою штучних мікро-рнк

Завантаження...

Номер патенту: 113948

Опубліковано: 10.04.2017

Автор: МакГонігл Брайан

МПК: C12N 15/82, A01H 5/00

Мітки: гена, даун-регуляція, мікро-рнк, штучних, експресії, допомогою

Формула / Реферат:

1. Виділений фрагмент нуклеїнової кислоти, що включає дезоксирибонуклеотидну послідовність, як описано в SEQ ID NO: 14, де (і) нуклеотиди 110-130 у SEQ ID NO: 14 заміщені першою мінливою нуклеотидною субпослідовністю, розмір якої варіює від 19 до 24 нуклеотидів залежно від мішеневої послідовності, чия експресія підлягає зниженню, (іі) нуклеотиди 184-203 у SEQ ID NO: 14 заміщені другою мінливою нуклеотидною субпослідовністю, розмір якої...

Спосіб прогнозування перебігу панкреатиту за поліморфізмом гена il-4 (c-590т)

Завантаження...

Номер патенту: 114383

Опубліковано: 10.03.2017

Автор: Іващук Сергій Іванович

МПК: G01N 33/50

Мітки: спосіб, c-590т, гена, панкреатиту, перебігу, прогнозування, поліморфізмом

Формула / Реферат:

Спосіб прогнозування перебігу панкреатиту за поліморфізмом гена IL-4 (С-590Т) шляхом визначення поліморфізму певного кандидатного гена з використанням полімеразної ланцюгової реакції, який відрізняється тим, що визначають поліморфізм С-590Т гена інтерлейкіну 4 IL-4, використовують як показник лабораторного контролю клінічного перебігу панкреатиту рівень активності печінкових ферментів аланінамінотрансферази та аспартатамінотрансферази та...

Спосіб прогнозування перебігу панкреатиту за поліморфізмом гена cftr (delf508)

Завантаження...

Номер патенту: 114303

Опубліковано: 10.03.2017

Автори: Сидорчук Лариса Петрівна, Іващук Сергій Іванович

МПК: G01N 33/50

Мітки: поліморфізмом, панкреатиту, гена, перебігу, delf508, прогнозування, спосіб

Формула / Реферат:

Спосіб прогнозування перебігу панкреатиту за поліморфізмом гена CFTR (delF508) шляхом визначення поліморфізму певного кандидатного гена з використанням полімеразної ланцюгової реакції, який відрізняється тим, що визначають поліморфізм delF508 гена трансмембранного регуляторного білка муковісцидозу CFTR, використовують як показник лабораторного контролю клінічного перебігу панкреатиту рівень тригліцеридів крові хворого; наявність NN-генотипу...

Спосіб визначення мутацій гена notch1

Завантаження...

Номер патенту: 112949

Опубліковано: 10.01.2017

Автори: Чумак Анатолій Андрійович, Білоус Надія Іванівна, Абраменко Ірина Вікторівна

МПК: C12Q 1/68

Мітки: спосіб, мутацій, notch1, визначення, гена

Формула / Реферат:

Спосіб визначення мутацій гена NOTCH1, що включає отримання генетичного матеріалу з клітин периферичної крові, ампліфікацію фрагмента гена в ділянці мутації у присутності барвника SYBR green в режимі реального часу та оцінку рівня ампліфікації порівняно з контрольним геном b-мікроглобуліну (В2М) за значенням порогового дельта циклу (DСТ) і характеристиками кривої плавлення, який відрізняється тим, що порівнюється рівень експресії мутованого...

Спосіб оцінки впливу поліморфізмів м235т гена agt на ефективність диференційованої профілактики та лікування хворих з цукровим діабетом 2 типу і артеріальною гіпертензією за понятовською т.ю.

Завантаження...

Номер патенту: 112939

Опубліковано: 10.11.2016

Автор: Понятовська Тетяна Юріївна

МПК: A61B 10/00

Мітки: гіпертензією, хворих, оцінки, м235т, діабетом, понятовською, профілактики, впливу, лікування, поліморфізмів, типу, диференційованої, артеріальною, ефективність, спосіб, цукровим, т.ю, гена

Формула / Реферат:

Спосіб оцінки впливу поліморфізмів М235Т гена AGT на ефективність диференційованої профілактики і лікування хворих з цукровим діабетом 2 типу та артеріальною гіпертензією шляхом визначення поліморфізмів гена AGT, який відрізняється тим, що досліджують наявність поліморфізмів гена AGT методом піросеквенування і при визначенні гомозиготного генотипу визначають як більш ефективний нефропротекторний блокатор ангіотензин-1...

Спосіб отримання інтерлейкіну-7 людини за допомогою рекомбінантної молекули, рекомбінантна молекула, що містить кднкову копію структурної частини сплайсованого кднк гена інтерлейкіну-7 людини та експресійного в

Завантаження...

Номер патенту: 112442

Опубліковано: 12.09.2016

Автор: ТОВАРИСТВО З ОБМЕЖЕНОЮ ВІДПОВІДАЛЬНІСТЮ "УНІВЕРСАЛЬНЕ АГЕНТСТВО "ПРО-ФАРМА"

МПК: C12N 1/21, C07K 14/54, C07K 17/02 ...

Мітки: частини, молекули, структурної, гена, спосіб, людини, рекомбінантна, містить, кднкову, копію, отримання, інтерлейкіну-7, сплайсованого, молекула, рекомбінантної, кднк, допомогою, експресійного

Формула / Реферат:

1. Спосіб отримання біологічно активної форми інтерлейкіну-7 людини за допомогою рекомбінантної молекули, що містить кДНКову копію структурної частини сплайсованого кДНК гена інтерлейкіну-7 людини та необхідні службові послідовності, причому рекомбінантну молекулу вбудовують в плазміду pACYC_IL7s, яка позначена на Фіг. 2, і вводять в бактерію E. coli BL21(DE3), де ДНК-послідовність кДНКової копії на 100 % співпадає з відповідними...

Спосіб діагностики розвитку та прогресування хронічної серцевої недостатності у хворих на ішемічну хворобу серця, поєднану з ожирінням, за поліморфізмом гена ендотеліальної синтази оксиду азоту

Завантаження...

Номер патенту: 108077

Опубліковано: 24.06.2016

Автори: Кравчун Павло Григорович, Кадикова Ольга Ігорівна

МПК: G01N 33/48

Мітки: ожирінням, ішемічну, гена, серця, азоту, недостатності, хворобу, поліморфізмом, ендотеліальної, прогресування, поєднану, серцевої, розвитку, діагностики, хворих, спосіб, синтази, оксиду, хронічної

Формула / Реферат:

Спосіб діагностики розвитку та прогресування хронічної серцевої недостатності, що включає оцінку вимірів загальноклінічних та інструментальних обстежень, який відрізняється тим, що у хворих з поєднаним перебігом ішемічної хвороби серця та ожиріння додатково оцінюють поліморфізм гена ендотеліальної синтази оксиду азоту (eNOS) і при наявності G алеля та G/G генотипу поліморфізму гена ендотеліальної синтази оксиду азоту (Glu298Asp) діагностують...

Спосіб прогнозування активності цитологічного синдрому у хворих на неалкогольну жирову хворобу печінки з урахуванням поліморфізму гена глутатіон-s-трансферази

Завантаження...

Номер патенту: 105909

Опубліковано: 11.04.2016

Автори: Присяжнюк Василь Петрович, Сидорчук Лариса Петрівна

МПК: A61P 1/16, A61K 35/407

Мітки: прогнозування, хворобу, урахуванням, глутатіон-s-трансферази, синдрому, поліморфізму, спосіб, цитологічного, печінки, хворих, гена, жирову, активності, неалкогольну

Формула / Реферат:

Спосіб прогнозування активності цитолітичного синдрому у хворих на неалкогольну жирову хворобу печінки з урахуванням поліморфізму гена глутатіон-S-трансферази шляхом проведення комплексного діагностичного дослідження та визначення показників ліпідного профілю, який відрізняється тим, що додатково досліджують A313G поліморфізм гена GSTP1 з метою визначення G-алеля зазначеного гена і при його виявленні прогнозують ймовірно вищу активність...

Спосіб визначення днк бактерій виду chlamydia abortus, chlamydia pecorum, chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу р (rnase p rna)

Завантаження...

Номер патенту: 110546

Опубліковано: 12.01.2016

Автори: Ксьонз Ігор Миколайович, Цівенко Тетяна Михайлівна, Почерняєв Костянтин Федорович

МПК: C12R 1/01, C12Q 1/68

Мітки: ендорибонуклеазу, abortus, днк, ланцюговий, ампліфікації, rnase, кодує, гена, реакції, шляхом, бактерій, полімеразній, chlamydia, виду, визначення, pecorum, фрагмента, спосіб, psittaci

Формула / Реферат:

Спосіб визначення ДНК бактерій виду Chlamydia abortus, Chlamydia pecorum, Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу Р (RNase Р RNA), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки фрагмента гена RNase Р RNA здійснюють за допомогою пари праймерів: прямого:CHCPF:5`-GGAGAAACTCCAGGGGCCGT-3` та зворотного:...

Спосіб оцінки впливу поліморфізмів м235т гена agt на ефективність диференційованої профілактики та лікування хворих з цукровим діабетом 2 типу і артеріальною гіпертензією за понятовською т.ю.

Завантаження...

Номер патенту: 103751

Опубліковано: 25.12.2015

Автор: Понятовська Тетяна Юріївна

МПК: A61B 10/00

Мітки: понятовською, гена, профілактики, впливу, т.ю, діабетом, оцінки, м235т, гіпертензією, хворих, типу, поліморфізмів, диференційованої, лікування, ефективність, артеріальною, спосіб, цукровим

Формула / Реферат:

Спосіб оцінки впливу поліморфізмів М235Т гена AGT на ефективність диференційованої профілактики і лікування хворих з цукровим діабетом 2 типу та артеріальною гіпертензією шляхом визначення поліморфізмів гена АПФ, який відрізняється тим, що досліджують наявність поліморфізмів гена AGT методом піросеквенування і при визначенні гомозиготного генотипу визначають як більш ефективний нефропротекторний блокатор ангіотензин-1 (Лозартран).

Спосіб визначення днк бактерій chlamydia felis у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр)

Завантаження...

Номер патенту: 109489

Опубліковано: 25.08.2015

Автори: Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович, Цівенко Тетяна Михайлівна

МПК: C12Q 1/68, C12R 1/01

Мітки: мембрани, chlamydia, ампліфікації, реакції, момр, ланцюговий, білка, головного, гена, шляхом, полімеразній, фрагменту, спосіб, felis, днк, бактерій, визначення

Формула / Реферат:

Спосіб визначення ДНК збудника хламідійних інфекцій домашніх котів у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки ДНК МОМР бактерії Chlamydia felis здійснюють з використанням пари праймерів: прямого CHFMF 5'-GCAGCTTCTGGAACTGCAAGC-3' та зворотного CHFMR 5'-GGCGАААТСAGTTCCTGCAAGА-3' з одержанням...

Застосування гена регулювання висоти рослин

Завантаження...

Номер патенту: 109249

Опубліковано: 10.08.2015

Автори: Лі Цюнь, Хі Зухуа, Жанг Іньінь

МПК: C07K 14/415, C12N 15/29, A01H 5/00 ...

Мітки: висоті, регулювання, застосування, гена, рослин

Формула / Реферат:

1. Застосування поліпептиду регулювання висоти рослини, або полінуклеотиду, що кодує поліпептид регулювання висоти рослини, у покращенні агрономічних характеристик рослини шляхом регулювання висоти рослини, розміру, кущіння, врожайності, розміру квіткового органа або розміру насіння рослини, де поліпептид регулювання висоти рослини вибраний з групи, яка включає:(a) поліпептид, що має амінокислотну послідовність, викладену у SEQ ID NO:...

Спосіб збільшення виходу насіння рослини шляхом руйнування гена ahp6

Завантаження...

Номер патенту: 109040

Опубліковано: 10.07.2015

Автори: Шмюллінг Томас, Вернер Томас

МПК: C07K 14/415, A01H 5/00, A01H 5/04 ...

Мітки: шляхом, гена, виходу, рослини, насіння, руйнування, збільшення, спосіб

Формула / Реферат:

1. Спосіб збільшення виходу насіння рослини, що включає руйнування ендогенного гена AHP6 у клітинах рослини, при цьому дане руйнування пригнічує експресію й (або) активність продукту вищезгаданого ендогенного гена AHP6 у порівнянні з відповідною контрольною рослиною, у відповідному гені якої немає зазначеного руйнування, причому ендогенний ген AHP6 включає або складається з: (а) нуклеїнової кислоти, що кодує білок AHP6 і включає...

Спосіб корекції ендотеліальної дисфункції при неалкогольному стеатогепатиті, поєднаному з хронічним обструктивним захворюванням легень залежно від поліморфізму гена

Завантаження...

Номер патенту: 94389

Опубліковано: 10.11.2014

Автори: Федів Олександр Іванович, Ступницька Ганна Ярославівна, Цинтар Тетяна Петрівна

МПК: G01N 33/48

Мітки: обструктивним, спосіб, гена, легень, ендотеліальної, неалкогольному, корекції, дисфункції, поєднаному, стеатогепатиті, захворюванням, хронічним, залежно, поліморфізму

Формула / Реферат:

Спосіб корекції ендотеліальної дисфункції при неалкогольному стеатогепатиті, поєднаному із хронічним обструктивним захворюванням легень шляхом призначення L-аргініну (тівортіну), який відрізняється тим, що тівортін призначають залежно від рівня нітритів/нітратів в крові та поліморфізму гена T894G ендотеліальної NO-синтази: при нормальній концентрації нітритів/нітратів або при їх незначному зростанні та за наявності генотипу 894GG 4,2 %...

Спосіб визначення однонуклеотидних поліморфізмів гена матриксної металопротеїнази 20

Завантаження...

Номер патенту: 93849

Опубліковано: 27.10.2014

Автори: Ткаченко Ірина Михайлівна, Шликова Оксана Анатоліївна, Весніна Людмила Едуардівна, Кайдашев Ігор Петрович, Труфанова Валентина Петрівна

МПК: G01N 1/00, A61B 5/00

Мітки: визначення, спосіб, металопротеїнази, однонуклеотидних, гена, поліморфізмів, матриксної

Формула / Реферат:

Спосіб визначення однонуклеотидних поліморфізмів гена матриксної металопротеїнази 20, який включає молекулярно-біологічний метод одночасного виявлення наявності "дикої" та мутантної алелі гена за допомогою полімеразної ланцюгової реакції в режимі реального часу, який відрізняється тим, що врахування результатів ведуть з аналізом кривих плавлення ДНК дуплексів та флуоресцентною реєстрацією накопичення ДНК за флуоресцентними...

Порушення гена ckx3 та принаймні одного іншого гена ckx у рослині або рослинній клітині, що приводить до поліпшених ознак

Завантаження...

Номер патенту: 106621

Опубліковано: 25.09.2014

Автори: Шмюллінг Томас, Вернер Томаш, Бартріна і Маннс Ізабель

МПК: C12N 15/82

Мітки: гена, клітині, іншого, приводить, поліпшених, рослини, рослинній, принаймні, ознак, одного, порушення

Формула / Реферат:

1. Ізольована рослинна клітина, що включає порушення принаймні у:і) ендогенному СКХ3 гені, який кодує цитокініноксидазу/дегідрогеназу, що включає поліпептидну послідовність, яка є ідентичною або має принаймні 95 % ідентичності з SEQ ID NО: 1 або її ортологом;таіі) одному додатковому ендогенному гені, що кодує цитокініноксидазу/дегідрогеназу та є відмінним від гена, який є визначеним у і);де вказані порушення...

Спосіб прогнозування нейросенсорної приглухуватості у дітей залежно від генотипу гена конексину (сх26) бета 2

Завантаження...

Номер патенту: 90488

Опубліковано: 26.05.2014

Автори: Кушнір Оксана Василівна, Іфтода Оксана Миколаївна, Сидорчук Лариса Петрівна

МПК: A61B 5/0488, A61B 5/12

Мітки: прогнозування, конексину, сх26, залежно, генотипу, дітей, бета, спосіб, приглухуватості, гена, нейросенсорної

Формула / Реферат:

Спосіб прогнозування нейросенсорної приглухуватості у дітей залежно від генотипу гена конексину (Сх26) бета 2 шляхом визначення даних комп'ютерної аудіометрії, який відрізняється тим, що додатково виконують імпедансометрію, тимпанометрію і аналізують алельний стан гена GJB2 (rs 121011), причому носіїв гомозиготної "мутації" 35delG гена GJB2 відносять до груп із високою прогностичною цінністю позитивного результату появи тяжких форм...

Спосіб визначення ампліфікації гена mycn у дітей, хворих на нейробластому

Завантаження...

Номер патенту: 86355

Опубліковано: 25.12.2013

Автори: Климнюк Григорій Іванович, Скачкова Оксана Володимирівна, Храновська Наталя Миколаївна, Павлик Сергій Володимирович, Свергун Наталія Миколаївна, Шайда Елена Вікторівна, Іонкіна Наталія Валеріївна

МПК: A61B 10/00, G01N 33/00

Мітки: визначення, нейробластому, гена, ампліфікації, хворих, дітей, спосіб

Формула / Реферат:

Спосіб визначення ампліфікації гена MYCN у дітей, хворих на нейробластому, що включає дослідження методом полімеразно-ланцюгової реакції з використанням специфічних праймерів, який відрізняється тим, що полімеразно-ланцюгову реакцію проводять з використанням специфічних TaqMan-зондів MGB-типу з детекцією результатів в режимі реального часу та при виявлені в пухлинній клітині ампліфікацію гена MYCN більше 10 копій, прогнозують несприятливий...

Спосіб визначення однонуклеотидного поліморфізму g28197a>g гена еластину методом алель-специфічної полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 85434

Опубліковано: 25.11.2013

Автори: Шликова Оксана Анатоліївна, Скрипник Володимир Михайлович, Аветіков Давид Соломонович, Весніна Людмила Едуардівна, Кайдашев Ігор Петрович, Воровський Олег Олегович

МПК: A61B 5/00, G01N 1/00

Мітки: гена, еластину, поліморфізму, полімеразної, визначення, однонуклеотидного, спосіб, g28197a>g, алель-специфічної, ланцюгової, методом, реакції

Формула / Реферат:

Спосіб визначення однонуклеотидного поліморфізму g28197A>G гена еластину методом алель-специфічної полімеразної ланцюгової реакції, що включає визначення наявності поліморфних алелей А та G, який відрізняється тим, що одночасно виявляється наявність "дикої" та мутантної алелі за допомогою полімеразної ланцюгової реакції з парою алель-специфічних праймерів та парою специфічних проб, мічених флуоресцентними барвниками FAM і R6G з...