Патенти з міткою «днк»

Спосіб контролю денатурації днк при використанні електрофорезу у поліакриламідному гелі

Завантаження...

Номер патенту: 123147

Опубліковано: 12.02.2018

Автори: Ляшенко Юрій Володимирович, Юрко Поліна Сергіївна, Кулібаба Роман Олександрович

МПК: G01N 33/483

Мітки: поліакриламідному, денатурації, контролю, гелі, електрофорезу, днк, використанні, спосіб

Формула / Реферат:

Спосіб контролю денатурації ДНК при використанні електрофорезу у поліакриламідному гелі застосовується шляхом проведення електрофоретичного розподілу у денатуруючому поліакриламідному гелі ампліфікованих мікросателітних локусів, який відрізняється тим, що додатково до дослідних проб у кожному гелі використовують контрольний зразок, який містить ампліфікований цільовий фрагмент ядерної ДНК гомозиготної особини виду Gallus gallus, що містить у...

Спосіб індикації днк бактерії chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 123070

Опубліковано: 12.02.2018

Автори: Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: C12Q 1/68, A61K 39/118, C12R 1/01 ...

Мітки: avium, момр, білка, реакції, ланцюговий, диференціації, головного, днк, ампліфікації, видової, спосіб, мембрани, бактерії, chlamydia, шляхом, індикації, фрагменту, полімеразній, гена

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia avium здійснюють за допомогою пари праймерів: прямого: ChAvMOMPL: 5' - TTCTGGTGATCCTTGCGACC-3' та зворотного: ChAvMOMPR: 5'- GCTCCTAAAGTTGCACAACC - 3', з одержанням...

Спосіб введення молекули чужорідної днк в попередньо визначений сайт в геномі рослинної клітини

Завантаження...

Номер патенту: 115961

Опубліковано: 25.01.2018

Автор: БАЙЄР КРОПСАЄНС НВ

МПК: C12N 15/82

Мітки: визначений, сайт, введення, попередньо, молекули, геномі, днк, рослинної, клітині, чужорідної, спосіб

Формула / Реферат:

1. Спосіб введення молекули чужорідної ДНК в попередньо визначений сайт в геномі рослинної клітини, який включає етапи:а) індукування двонитчастого розриву ДНК в попередньо визначеному сайті;b) введення вказаної молекули чужорідної ДНК у вказану рослинну клітину; іс) відбору рослинної клітини, в якій вказана чужорідна ДНК є введеною у вказаний попередньо визначений сайт;який відрізняється тим, що вказаним...

Рекомбінантна молекула днк, яка вказує на присутність трансгенної події mon 87427 маїсу

Завантаження...

Номер патенту: 115762

Опубліковано: 26.12.2017

Автори: Фен Пол К.К., Фонсека Агустін Е., Ци Юлінь, Стекер Мартін А., Ередіа Оскар, Келлі Ребекка А., Гарнаат Карл У., Хуан Цзиньтай

МПК: C12N 15/82, A01H 5/00, C12N 15/29 ...

Мітки: яка, події, присутність, масу, молекула, вказує, днк, 87427, рекомбінантна, трансгенної

Формула / Реферат:

1. Рекомбінантна молекула ДНК, яка містить нуклеотидну послідовність, вибрану з групи, яка складається з SEQ ID NO: 1-8 і SEQ ID NO: 10, де вказана рекомбінантна молекула ДНК вказує на присутність події MON 87427, де вказана подія MON 87427 має нуклеотидну послідовність SEQ ID NO: 10, яка містить трансген, вбудований в геномну ДНК маїсу, і ділянки геномної ДНК маїсу, фланкуючі 3'- і 5'-кінці трансгенної вставки, де SEQ ID NO:...

Рекомбінантна молекула днк, яка вказує на присутність трансгенного об’єкта сої mon 87708

Завантаження...

Номер патенту: 115761

Опубліковано: 26.12.2017

Автори: Фен Пол. С.С., Гупта Анджу, Хой Шио-Вай, Брінкер Рональд Дж., Бернс Уен К., Ву Куншенг, Малвен Маріанне

МПК: A01H 5/00, C12N 15/82, C12N 15/29 ...

Мітки: яка, об'єкта, трансгенного, присутність, молекула, вказує, днк, рекомбінантна, сої, 87708

Формула / Реферат:

1. Рекомбінантна молекула ДНК, що містить нуклеотидну молекулу, яка містить нуклеотидну послідовність, вибрану з групи, яка складається з SEQ ID NO: 1-4 і 6-8 і комплементарних їм послідовностей, де вказана рекомбінантна молекула ДНК вказує на присутність трансгенного об'єкта MON 87708 і надавану тим самим наявність стійкості до дикамби, де вказаний трансгенний об’єкт MON 87708 має нуклеотидну послідовність SEQ ID NO: 6, яка містить...

Синтетична послідовність днк для експресії білка в клітинах кукурудзи та спосіб її застосування

Завантаження...

Номер патенту: 115526

Опубліковано: 27.11.2017

Автори: Мерло Дональд Дж., Тхірумалаісвамісекхар Арвінд Кумар, Вуслі Ерон Тод, Редді Авуту С., Ларрінуа Ігнасіо Маріо

МПК: C12N 5/04, C12N 5/10, C12N 15/82 ...

Мітки: білка, синтетична, послідовність, спосіб, днк, клітинах, застосування, експресії, кукурудзи

Формула / Реферат:

1. Синтетична послідовність ДНК для експресії білка, який представляє інтерес, в клітинах кукурудзи, яка містить:a) оптимізовану по кодонах послідовність ДНК, яка кодує білок, який представляє інтерес,b) щонайменше одну послідовність сигналу поліаденілювання, вибрану із групи, яка складається із класу I і класу II, де:клас I вибирають із групи, яка складається із AATAAA, AATAAT, AACCAA, ATATAA, AATCAA, ATACTA, ATAAAA,...

Спосіб виявлення дезоксирибонуклеїнової кислоти (днк) бактерій cronobacter spp. (enterobacter sakazakii)

Завантаження...

Номер патенту: 118844

Опубліковано: 28.08.2017

Автори: Касянчук Вікторія Вікторівна, Бергілевич Олександра Миколаївна, Дерябін Олег Миколайович, Коростіль Сергій Олексійович, Моня Юлія Іванівна, Терьохіна Олена Вікторівна

МПК: C12Q 1/68, C12R 1/01

Мітки: enterobacter, sakazakii, днк, спосіб, бактерій, виявлення, дезоксирибонуклеїнової, cronobacter, кислоти

Формула / Реферат:

Спосіб виявлення дезоксирибонуклеїнової кислоти (ДНК) бактерій Cronobacter spp. (Enterobacter sakazakii), що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) за допомогою мультиплексного варіанту полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно синтезовані олігонуклеотидні праймери, які є специфічними фрагментами до гену 16S rRNA, з наступною...

Спосіб індикації днк бактерії chlamydia pneumoniae у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 117492

Опубліковано: 26.06.2017

Автори: Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: A61K 39/118

Мітки: момр, бактерії, полімеразній, шляхом, pneumoniae, видової, спосіб, ампліфікації, фрагмента, chlamydia, ланцюговий, індикації, гена, мембрани, диференціації, головного, днк, реакції, білка

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia рnеumoniae у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia рnеumoniae здійснюють за допомогою пари праймерів: прямого: ChPnMOMPL: 5'-GGAACAAAGTCTGCGACCAT-3' та зворотного: ChPnMOMPR: 5'-AAAGAAGGGTTCCATGCAGTT-3', з...

Спосіб індикації днк бактерії chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117100

Опубліковано: 12.06.2017

Автори: Ксьонз Ігор Миколайович, Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович

МПК: C12Q 1/68, C12R 1/01

Мітки: спосіб, диференціації, білка, реакції, полімеразній, шляхом, мембрани, chlamydia, фрагмента, pecorum, індикації, гена, бактерії, днк, ампліфікації, видової, ланцюговий, головного, момp

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia pecorum здійснюють за допомогою пари праймерів: прямого: ChPecMOMPL 5'-TCCAATACGCACAATCGAAA-3' та зворотного: ChPecMOMPR 5'-GTAAGACAACGCTGCACCAA-3', з одержанням...

Спосіб індикації днк бактерії chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117099

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: C12Q 1/68, C12R 1/01

Мітки: індикації, спосіб, реакції, бактерії, мембрани, момp, білка, ампліфікації, головного, chlamydia, фрагмента, полімеразній, диференціації, ланцюговий, днк, видової, шляхом, гена

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia suis здійснюють за допомогою пари праймерів: прямого: ChSuMOMPL: 5'- TTCTTTGCAATGCTGCTGAA-3' та зворотного: ChSuMOMPR: 5'- ATCAAAGCTTGCTCGAGACC-3', з одержанням...

Спосіб індикації днк бактерії chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 117097

Опубліковано: 12.06.2017

Автори: Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович

МПК: C12R 1/01, C12Q 1/68

Мітки: бактерії, реакції, мембрани, білка, полімеразній, індикації, момр, фрагмента, chlamydia, шляхом, гена, спосіб, диференціації, днк, ампліфікації, ланцюговий, psittaci, головного, видової

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia psittaci здійснюють за допомогою пари праймерів: прямого: ChPsMOMPL: 5'-GCACTATGTGGGAAGGTGCT-3' та зворотного: ChPsMOMPR: 5'-CCATTTGCTTCTGGCTGATT-3', з одержанням...

Спосіб індикації днк бактерії chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117091

Опубліковано: 12.06.2017

Автори: Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович

МПК: C12R 1/01, C12Q 1/68

Мітки: chlamydia, білка, ланцюговий, головного, abortus, бактерії, спосіб, видової, індикації, диференціації, ампліфікації, днк, полімеразній, шляхом, реакції, гена, фрагмента, мембрани, момp

Формула / Реферат:

Спосіб індикації ДНК бактерій Chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР) для її видової диференціації, який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia abortus здійснюють за допомогою пари праймерів: прямого: ChAbMOMPL: 5'-GGATAGACCCAACATCGCTT-3' та зворотного: ChAbMOMPR:...

Спосіб виділення дезоксирибонуклеїнової кислоти (днк) з тканини злоякісної пухлини щитоподібної залози, що фіксована в формальдегіді та поміщена у парафіновий блок

Завантаження...

Номер патенту: 114665

Опубліковано: 10.03.2017

Автори: Сулік Володимир Володимирович, Мелоян Ані Робертовна, Дінець Андрій Володимирович, Храпач Василь Васильович, Мішалов Володимир Григорович

МПК: C12N 15/00

Мітки: виділення, фіксована, поміщена, тканини, дезоксирибонуклеїнової, днк, формальдегіді, кислоти, спосіб, злоякісної, щитоподібної, залози, блок, пухлини, парафіновий

Формула / Реферат:

Спосіб виділення дезоксирибонуклеїнової кислоти (ДНК) з тканини злоякісної пухлини щитоподібної залози, що фіксована в формальдегіді та заключна у парафін, що включає депарафінізацію тканини ксилолом інкубацією при кімнатній температурі (21-22 °C), який відрізняється тим, що попередньо перед етапом депарафінізації тканину обробляють мінеральною олією і проводять інкубацію протягом 20 хвилин при температурі 90 °C далі проводять...

Спосіб видалення ділянки днк в рослині

Завантаження...

Номер патенту: 113493

Опубліковано: 10.02.2017

Автори: Петоліно Джозеф Ф., Расел Шон

МПК: A01H 1/02, C12N 15/29, A01H 5/00 ...

Мітки: днк, рослини, видалення, ділянки, спосіб

Формула / Реферат:

1. Спосіб видалення ділянки ДНК в рослині, згідно з яким:надають першу життєздатну рослину, що містить геномну ДНК, де геномна ДНК містить ділянку ДНК і першу послідовність розпізнавання, що фланкує 3'-кінець, і другу послідовність розпізнавання, що фланкує 5'-кінець ділянки ДНК, де перша послідовність розпізнавання і друга послідовність розпізнавання ідентичні;вводять ДНК, яка кодує нуклеазу "цинкові пальці" у другу...

Трансгенна рослина, що містить днк, яка кодує інсектицидний білок сry1be, і днк, яка кодує інсектицидний білок сry1fa, для боротьби або попередження виникнення стійкості у spodoptera frugiperda та ostrinia nubilalis

Завантаження...

Номер патенту: 113385

Опубліковано: 25.01.2017

Автори: Шитс Джоел Дж., Вуслі Аарон Т., Сторер Ніколас П., Нарва Кеннет, Бертон Стефані Л., Мід Томас

МПК: A01H 5/00, A01H 5/10, A01N 63/02 ...

Мітки: сry1fa, містить, nubilalis, інсектицидний, попередження, ostrinia, днк, трансгенна, виникнення, білок, боротьби, сry1be, стійкості, рослина, кодує, frugiperda, яка, spodoptera

Формула / Реферат:

1. Трансгенна рослина, що містить ДНК, яка кодує інсектицидний білок Cry1Be, і ДНК, яка кодує інсектицидний білок Cry1Fa, де вказаний інсектицидний білок Cry1Fa щонайменше на 99 % ідентичний SEQ ID NO:1, і вказаний інсектицидний білок Cry1Be щонайменше на 99 % ідентичний SEQ ID NO:2, де вказаний інсектицидний білок Cry1Fa і вказаний інсектицидний білок Cry1Be мають різні ділянки зв'язування з рецептором в кишечнику FAW або ECB.2....

Застосування активності ендогенної днкази для зниження вмісту днк

Завантаження...

Номер патенту: 113293

Опубліковано: 10.01.2017

Автори: Ворд Майкл, Ко Дуґлас, Гофман Кетрин

МПК: C12N 1/08, C12Q 1/25

Мітки: вмісту, зниження, застосування, ендогенної, активності, днк, днкази

Формула / Реферат:

1. Спосіб зниження вмісту ДНК у бульйоні, у якому культивували клітини-хазяїни, що є клітинами нитчастих грибів, який включає наступні етапи:коригування pH і/або температури бульйону, у якому культивували грибні клітини-хазяїни протягом щонайменше 24 годин, зі збільшенням pH і/або температури, застосовуваних у культивуванні; таінкубування бульйону при збільшених pH та/або температурі протягом періоду, достатнього для зниження...

Трансгенна рослина, яка містить днк, що кодує і експресує інсектицидний білок cry1da, і днк, що кодує і експресує інсектицидний білок cry1fa, для боротьби з совкою трав’яною

Завантаження...

Номер патенту: 113273

Опубліковано: 10.01.2017

Автори: Нарва Кенет, Вуслі Ерон Т., Мід Томас, Сторер Ніколас П., Бертон Стефані Л., Шитс Джоел Дж.

МПК: A01H 5/10, A01N 63/02, A01H 5/00 ...

Мітки: кодує, cry1fa, боротьби, експресує, білок, трав'яною, яка, інсектицидний, днк, рослина, містить, cry1da, трансгенна, совкою

Формула / Реферат:

1. Трансгенна рослина, яка містить ДНК, що кодує і експресує інсектицидний білок Cry1Da, і ДНК, що кодує і експресує інсектицидний білок Cry1Fa.2. Трансгенна насінина рослини за п. 1, яка містить ДНК, що кодує і експресує інсектицидний білок Cry1Da, і ДНК, що кодує і експресує інсектицидний білок Cry1Fa.3. Трансгенна рослина за п. 1, де ДНК, що кодує і експресує інсектицидний білок Cry1Da, і ДНК, що кодує і експресує...

Спосіб виявлення дезоксирибонуклеїнової кислоти (днк) шигатоксинпродукуючих бактерій е. coli (stec)

Завантаження...

Номер патенту: 112623

Опубліковано: 26.12.2016

Автори: Дерябін Олег Миколайович, Кустуров Володимир Борисович, Сміянов Владислав Анатолійович, Бергілевич Олександра Миколаївна, Єфімова Ольга Миколаївна, Касянчук Вікторія Вікторівна

МПК: A61K 39/108, G01N 1/00

Мітки: днк, бактерій, кислоти, шигатоксинпродукуючих, дезоксирибонуклеїнової, stec, виявлення, спосіб

Формула / Реферат:

Спосіб виявлення дезоксирибонуклеїнової кислоти (ДНК) шигатоксинпродукуючих бактерій E. coli (STEC), що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) за допомогою мультиплексного варіанта полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно синтезовані олігонуклеотидні праймери з наступною послідовністю нуклеотидів:для гена токсину stx2...

Трансгенна рослина, яка містить днк, що кодує білок cry1da, і днк, що кодує білок cry1ca, для керування стійкими комахами spodoptera frugiperda

Завантаження...

Номер патенту: 112409

Опубліковано: 12.09.2016

Автори: Вуслі Аарон Т., Нарва Кеннет, Шитс Джоел Дж., Мід Томас, Бертон Стефані Л., Сторер Ніколас П.

МПК: A01H 5/10, A01N 63/02, A01H 5/00 ...

Мітки: frugiperda, яка, керування, рослина, cry1ca, днк, трансгенна, комахами, кодує, білок, містить, стійкими, cry1da, spodoptera

Формула / Реферат:

1. Трансгенна рослина, яка містить ДНК, що кодує білок Cry1Da, який має інсектицидну дію, і ДНК, що кодує білок Сrу1Са, який має інсектицидну дію.2. Трансгенна рослина за п. 1, де вказана рослина додатково містить ДНК, що кодує третій білок, який має інсектицидну дію, при цьому вказаний третій білок вибирають із групи, яка складається з Cry1Fa, Vip3Ab, Cry1Be i Cry1E.3. Трансгенна рослина за п. 2, де вказаний третій білок, який...

Трансгенна рослина, що містить днк, яка кодує інсектицидний білок cry1cа та cry1аb для боротьби з лускокрилими шкідниками

Завантаження...

Номер патенту: 112287

Опубліковано: 25.08.2016

Автори: Бертон Стефані Л., Шитс Джоел Дж., Нарва Кеннет, Вуслі Аарон Т., Сторер Ніколас П., Мід Томас

МПК: A01N 63/02, C07K 14/325, C12N 15/82 ...

Мітки: рослина, інсектицидний, cry1ab, лускокрилими, шкідниками, містить, трансгенна, днк, cry1ca, білок, яка, боротьби, кодує

Формула / Реферат:

1. Трансгенна рослина, що має стійкість до комах-шкідників кукурудзяної листової совки (FAW; Spodoptera frugiperda) і/або вогнівки цукрової тростини (SCB; Diatraea saccharalis), що містить ДНК, яка кодує інсектицидний білок Cry1Ca з послідовністю SEQ ID NO: 2, і ДНК, яка кодує інсектицидний білок Cry1Ab з послідовністю SEQ ID NO: 3; де вказану рослину вибирають з групи, що складається з кукурудзи, сої, цукрової тростини і бавовни.2....

Трансгенна рослина, яка містить днк, що кодує інсектицидний білок сry1ca, і днк, що кодує інсектицидний білок сry1fa, для вироблення резистентності до комах

Завантаження...

Номер патенту: 112156

Опубліковано: 10.08.2016

Автори: Сторер Ніколас П., Вуслі Аарон Т., Шитс Джоел Дж., Нарва Кеннет, Бертон Стефані Л., Мід Томас

МПК: A01H 5/10, A01H 5/00, A01N 63/02 ...

Мітки: сry1fa, рослина, містить, сry1ca, комах, резистентності, білок, кодує, вироблення, днк, яка, інсектицидний, трансгенна

Формула / Реферат:

1. Трансгенна рослина, яка містить ДНК, що кодує інсектицидний білок Cry1Cа, і ДНК, що кодує інсектицидний білок Cry1Fа.2. Трансгенне насіння рослини за п. 1, яке містить ДНК, що кодує інсектицидний білок Cry1Cа, і ДНК, що кодує інсектицидний білок Cry1Fа.3. Трансгенна рослина за п. 1, де ДНК, що кодує інсектицидний білок Cry1Cа, і ДНК, що кодує інсектицидний білок Cry1Fа, були введені у вказану рослину шляхом інтрогресії....

Спосіб виділення дезоксирибонуклеїнової кислоти (днк) з парафінових гістологічних блоків

Завантаження...

Номер патенту: 108736

Опубліковано: 25.07.2016

Автори: Кузенко Євген Вікторович, Романюк Анатолій Миколайович, Линдін Микола Сергійович

МПК: C12N 15/10

Мітки: гістологічних, спосіб, парафінових, дезоксирибонуклеїнової, днк, блоків, кислоти, виділення

Формула / Реферат:

Спосіб виділення дезоксирибонуклеїнової кислоти (ДНК) з парафінових гістологічних блоків, що включає отримання на мікротомі парафінізованих зрізів тканин із парафінізованого зразка тканин, підготовку їх гістологічним методом, депарафінізацію гістологічних зрізів, розділення розчину з ДНК шляхом центрифугування з наступним його виділенням, який відрізняється тим, що депарафінізацію підготовлених гістологічних зрізів здійснюють при кімнатній...

Трансгенна рослина цукрової тростини, яка містить днк, що кодує інсектицидний білок cry1fa, і днк, що кодує інсектицидний білок cry1ab, для боротьби з вогнівкою цукрової тростини

Завантаження...

Номер патенту: 112056

Опубліковано: 25.07.2016

Автори: Мід Томас, Шитс Джоел Дж., Сторер Ніколас П., Нарва Кеннет, Бертон Стефані Л.

МПК: A01H 5/00, A01H 5/10, A01N 63/02 ...

Мітки: білок, cry1fa, кодує, рослина, боротьби, cry1ab, тростини, трансгенна, днк, вогнівкою, яка, цукрової, містить, інсектицидний

Формула / Реферат:

1. Трансгенна рослина цукрової тростини, яка містить ДНК, що кодує інсектицидний білок Cry1Fa, і ДНК, що кодує інсектицидний білок Cry1Ab.2. Трансгенна рослина цукрової тростини за п. 1, в якій ДНК, що кодує коровий токсиновмісний білок Cry1Fa, і ДНК, що кодує коровий токсиновмісний білок Cry1Ab, інтрогресовані у вказану рослину цукрової тростини.3. Частина трансгенної рослини за п. 1, яка містить ДНК, що кодує інсектицидний...

Трансгенна рослина, яка містить днк, що кодує інсектицидний білок vip3ab, і днк, що кодує інсектицидний білок cry1ca, для керування резистентністю комах

Завантаження...

Номер патенту: 111936

Опубліковано: 11.07.2016

Автори: Мід Томас, Шитс Джоел Дж., Нарва Кеннет, Сторер Ніколас П., Вуслі Аарон Т., Бертон Стефані Л.

МПК: A01N 63/02, A01H 5/00, A01H 5/10 ...

Мітки: cry1ca, яка, резистентністю, трансгенна, інсектицидний, днк, комах, рослина, містить, кодує, vip3ab, білок, керування

Формула / Реферат:

1. Трансгенна рослина, яка містить ДНК, що кодує білок Vip3Ab, який має інсектицидну дію, і ДНК, що кодує білок Cry1Сa, який має інсектицидну дію.2. Трансгенна рослина за п. 1, де вказана рослина додатково містить ДНК, що кодує третій білок, який має інсектицидну дію, при цьому вказаний третій білок вибирають з групи, що складається з Cry1Fa, Cry1Da, Cry1Be і Cry1E.3. Трансгенна рослина за п. 2, де вказаний третій білок...

Трансгенна рослина, яка містить днк, що кодує інсектицидний білок cry1ab, і днк, що кодує інсектицидний білок cry1be, для керування резистентністю комах

Завантаження...

Номер патенту: 111935

Опубліковано: 11.07.2016

Автори: Сторер Ніколас П., Мід Томас, Бертон Стефані Л., Шитс Джоел Дж., Вуслі Аарон Т., Нарва Кеннет

МПК: A01H 5/10, A01N 63/02, A01H 5/00 ...

Мітки: керування, трансгенна, білок, кодує, днк, яка, комах, рослина, містить, резистентністю, інсектицидний, cry1ab, cry1be

Формула / Реферат:

1. Трансгенна рослина, яка містить ДНК, що кодує інсектицидний білок Cry1Ab, і ДНК, що кодує інсектицидний білок Cry1Be.2. Трансгенна рослина за п. 1, де вказана рослина додатково містить ДНК, що кодує третій інсектицидний білок, де вказаний третій білок вибраний з групи, що складається з Cry2A, Cry1I і DIG-3.3. Трансгенна рослина за п. 2, де вказана рослина додатково містить ДНК, що кодує інсектицидний білок Cry1Fa, і ДНК, що...

Трансгенна рослина, що містить днк, яка кодує інсектицидний білок vip3ab, і днк, яка кодує інсектицидний білок cry1fa, стійка до лускокрилих шкідників

Завантаження...

Номер патенту: 111934

Опубліковано: 11.07.2016

Автори: Нарва Кеннет, Сторер Ніколас П., Мід Томас, Вуслі Аарон Т., Бертон Стефані Л., Шитс Джоел Дж.

МПК: A01H 5/00, A01H 5/10, A01N 63/02 ...

Мітки: стійка, vip3ab, трансгенна, яка, містить, лускокрилих, кодує, інсектицидний, cry1fa, днк, рослина, білок, шкідників

Формула / Реферат:

1. Трансгенна рослина, що містить ДНК, яка кодує інсектицидний білок Vip3Ab, і ДНК, яка кодує інсектицидний білок Cry1Fa, де вказаний інсектицидний білок Cry1Fa є щонайменше на 95 % ідентичним SEQ ID NO:1, і вказаний інсектицидний білок Vip3Ab є щонайменше на 95 % ідентичним SEQ ID NO:2.2. Насінина рослини за п. 1, що містить ДНК, яка кодує інсектицидний білок Vip3Ab, і ДНК, яка кодує інсектицидний білок Cry1Fa.3....

Спосіб визначення днк бактерій виду chlamydia abortus, chlamydia pecorum, chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу р (rnase p rna)

Завантаження...

Номер патенту: 110546

Опубліковано: 12.01.2016

Автори: Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович, Цівенко Тетяна Михайлівна

МПК: C12Q 1/68, C12R 1/01

Мітки: полімеразній, ампліфікації, днк, abortus, psittaci, ланцюговий, визначення, кодує, ендорибонуклеазу, виду, rnase, реакції, гена, chlamydia, бактерій, шляхом, фрагмента, pecorum, спосіб

Формула / Реферат:

Спосіб визначення ДНК бактерій виду Chlamydia abortus, Chlamydia pecorum, Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу Р (RNase Р RNA), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки фрагмента гена RNase Р RNA здійснюють за допомогою пари праймерів: прямого:CHCPF:5`-GGAGAAACTCCAGGGGCCGT-3` та зворотного:...

Спосіб виявлення днк yersinia enterocolitica за допомогою “напівгніздового” методу полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 103102

Опубліковано: 10.12.2015

Автори: Головко Анатолій Миколаєвич, Дерябін Олег Миколайович, Виговська Лілія Миколаївна, Поліщук Наталія Миколаївна, Мачуський Олександр Вікторович, Ушкалов Артем Валерійович

МПК: A61K 31/00, C12Q 1/00, G01N 33/00 ...

Мітки: днк, полімеразної, ланцюгової, методу, допомогою, напівгніздового, спосіб, enterocolitica, виявлення, реакції, yersinia

Формула / Реферат:

Спосіб виявлення ДНК бактерії YERSINIA ENTEROCOLITICA за допомогою полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) збудника за допомогою "напівгніздового" варіанта полімеразної ланцюгової реакції (ПЛР) - ферментативної реакції і трьох штучно синтезованих олігонуклеотидних праймерів, які дозволяють багаторазово копіювати специфічні ділянки ДНК...

Спосіб зниження інфекційних властивостей днк- та рнк-вмісних вірусів

Завантаження...

Номер патенту: 101429

Опубліковано: 10.09.2015

Автори: Клестова Зінаїда Сергіївна, Дгебуадзе Шота, Вороніна Алла Костянтинівна, Ташута Віктор Сергійович

МПК: A61D 99/00, A61K 45/00, A61P 31/14 ...

Мітки: зниження, інфекційних, рнк-вмісних, спосіб, властивостей, вірусів, днк

Формула / Реферат:

Спосіб зниження інфекційних властивостей ДНК- та РНК-вмісних вірусів, який відрізняється тим, що застосовують як інгібітор вірусів індолвмісну конденсовану тетрациклічну сполуку 3Н-бензофуро(2,3-f)-1,2,3-бензотриазолу, при цьому процес здійснюють у культурах клітин тваринного походження ВНK-21, СНЕВ та SK-6 за використання трьох схем застосування сполуки.

Спосіб визначення днк бактерій chlamydia felis у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр)

Завантаження...

Номер патенту: 109489

Опубліковано: 25.08.2015

Автори: Цівенко Тетяна Михайлівна, Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: C12R 1/01, C12Q 1/68

Мітки: бактерій, мембрани, chlamydia, головного, ампліфікації, реакції, момр, білка, гена, днк, шляхом, полімеразній, ланцюговий, фрагменту, спосіб, визначення, felis

Формула / Реферат:

Спосіб визначення ДНК збудника хламідійних інфекцій домашніх котів у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки ДНК МОМР бактерії Chlamydia felis здійснюють з використанням пари праймерів: прямого CHFMF 5'-GCAGCTTCTGGAACTGCAAGC-3' та зворотного CHFMR 5'-GGCGАААТСAGTTCCTGCAAGА-3' з одержанням...

Спосіб виявлення днк патогенних лептоспір роду leptospira, виду leptospira interrogans у клінічному і патологічному матеріалі та зразках води за допомогою полімеразної ланцюгової реакції у режимі реального часу

Завантаження...

Номер патенту: 101190

Опубліковано: 25.08.2015

Автори: Кучерявенко Олександр Олександрович, Куликова Влада Вячеславівна, Уховський Віталій Вікторович

МПК: C07K 14/20

Мітки: допомогою, патогенних, патологічному, режимі, клінічному, зразках, днк, спосіб, реального, матеріали, leptospira, води, ланцюгової, interrogans, реакції, виду, виявлення, лептоспір, часу, полімеразної, роду

Формула / Реферат:

Спосіб виявлення ДНК патогенних лептоспір роду Leptospira, виду Leptospira interrogans у клінічному і патологічному матеріалі та зразках води за допомогою полімеразної ланцюгової реакції у реальному часі (ПЛР-РЧ), який здійснюють за допомогою специфічних фрагментів нуклеїнових кислот (ДНК) та гібридизаційно-флуоресценції детекції продуктів ампліфікації у режимі реального часу, який відрізняється тим, що результат ампліфікації ДНК патогенних...

Спосіб виявлення днк бактерії coxiella burnetii збудника ку-лихоманки за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 100232

Опубліковано: 10.07.2015

Автори: Неволько Олег Михайлович, Головко Анатолій Миколайович, Марущак Людмила Василівна, Дерябін Олег Миколайович

МПК: C12Q 1/68

Мітки: спосіб, днк, збудника, реакції, допомогою, burnetii, бактерії, ланцюгової, coxiella, ку-лихоманки, полімеразної, виявлення

Формула / Реферат:

Спосіб виявлення ДНК бактерії Coxiella burnetii збудника Ку-лихоманки за допомогою полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (НК) гену соm l, який кодує висококонсервативний білок зовнішньої мембрани з М.м 27kDа збудника Ку-лихоманки за допомогою полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно...

Спосіб отримання днк для полімеразно-ланцюгової реакції із тканин пухлини

Завантаження...

Номер патенту: 99734

Опубліковано: 25.06.2015

Автори: Лісяний Олександр Миколайович, Ключникова Антоніна Іванівна, Лісяний Микола Іванович, Малишева Тетяна Анатоліївна, Потапова Антоніна Ігнатіївна

МПК: C12N 15/00

Мітки: пухлини, полімеразно-ланцюгової, реакції, спосіб, отримання, тканин, днк

Формула / Реферат:

Спосіб отримання ДНК для полімеразно-ланцюгової реакції(ПЛР) із тканин пухлини, що є молекулярно-генетичним методом досліджень, який відрізняється тим, що для спрощення зберігання досліджуваних тканин та широкого і доступного використання методів на основі ПЛР, використовують фіксовані формаліном та заключні в парафін зразки різних тканин, в т.ч. пухлин людини, шляхом отримання із них гістологічних тонких зрізів товщиною до 10 нм, далі...

Спосіб визначення успадкування стійкості картоплі до раку synchytrium endobioticum (schilb) perc. плр аналізом днк

Завантаження...

Номер патенту: 99352

Опубліковано: 25.05.2015

Автори: Карелов Анатолій Валерійович, Пилипенко Лілія Амінівна, Захарчук Наталья Анатолівна, Зеля Аврелія Георгіївна, Бондарчук Анатолій Андрійович, Козуб Наталія Олександрівна, Фурдига Микола Миколайович, Олійник Тетяна Миколаївна, Борзих Олександр Іванович, Гунчак Володимир Михайлович, Зеля Георгій Віорелович

МПК: A01C 1/00

Мітки: спосіб, успадкування, раку, плр, картоплі, schilb, аналізом, synchytrium, perc, днк, стійкості, endobioticum, визначення

Формула / Реферат:

Спосіб визначення успадкування стійкості картоплі до раку Synchytrium endobioticum (Schilb) Perc, що включає зараження паростків картоплі літніми зооспорами збудника хвороби і їх аналіз, який відрізняється тим, що з вихідних батьківських форм картоплі, а також з гібридів, отриманих від комбінацій схрещування виділяють ДНК, проводять їх електрофорез в агарозному гелі і за виявленими продуктами ампліфікації ДНК ідентифікують сприйнятливі до...

Спосіб визначення днк культури lactococcus lactis subsp. lactis за допомогою специфічних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107897

Опубліковано: 25.02.2015

Автори: Вакуленко Микола Михайлович, Науменко Оксана Василівна, Жукова Ярослава Фрідріхівна, Малова Валерія Всеволодівна, Король Цвітана Олександрівна

МПК: C12N 15/00

Мітки: спосіб, днк, визначення, lactococcus, праймерів, реакції, полімеразної, культури, subsp, ланцюгової, допомогою, методом, специфічних, lactis

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. lactic за допомогою специфічних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культури Lactococcus lactis subsp. lactis, використовують пару олігонуклеотидних праймерів до гену асmА N-ацетилмурамідази:прямий...

Спосіб визначення днк культури lactococcus lactis subsp. cremoris методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107547

Опубліковано: 12.01.2015

Автори: Вакуленко Микола Михайлович, Семенівська Олена Анатоліївна, Малова Валерія Всеволодівна

МПК: C12N 15/09

Мітки: subsp, спосіб, ланцюгової, визначення, cremoris, методом, lactococcus, днк, реакції, полімеразної, культури, lactis

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. cremoris у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції,який відрізняється тим, що для визначення ДНК культур Lactococcus lactis subsp. cremoris, застосовують пару олігонуклеотидних праймерів до гену recN DNA repair protein:прямий праймер

Спосіб визначення днк культури lactococcus lactis subsp. lactis методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107546

Опубліковано: 12.01.2015

Автори: Малова Валерія Всеволодівна, Вакуленко Микола Михайлович, Семенівська Олена Анатоліївна

МПК: C12N 15/09

Мітки: днк, lactis, реакції, полімеразної, ланцюгової, визначення, lactococcus, культури, спосіб, subsp, методом

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. lactic у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції, який відрізняється тим, що для визначення ДНК культури Lactococcus lactis subsp. lactis застосовують пару олігонуклеотидних праймерів до гену recN DNA repair protein:прямий праймер recN F: 5'- CAGGCTGAAGAAATTGAAGC-3' 20 bp тазворотній праймер recN R: 5'-...

Спосіб отримання зразків тканини плаценти для подальшої діагностики днк збудників урогенітальних інфекцій методом полімеразно-ланцюгової реакції

Завантаження...

Номер патенту: 95219

Опубліковано: 10.12.2014

Автори: Задорожна Вікторія Іванівна, Безкоровайна Лілія Володимирівна, Покас Олена Вікторівна, Мартиненко Сергій Іванович, Вихристюк Ірина Олександрівна, Шаблій Володимир Анатолійович, Приходько Тетяна Олександрівна, Бойко Оксана Іванівна, Лобинцева Галина Степанівна, В'ялих Жанна Едуардівна, Ціленко Лариса Миколаївна

МПК: A61B 10/00, G01N 33/48

Мітки: отримання, урогенітальних, днк, діагностики, подальшої, реакції, методом, зразків, полімеразно-ланцюгової, інфекцій, плаценти, спосіб, тканини, збудникiв

Формула / Реферат:

Спосіб отримання зразків тканини плаценти для подальшої діагностики ДНК збудників урогенітальних інфекцій, що включає відбір зразка для досліджень, який відрізняється тим, що знімають амніотичну оболонку з плаценти з декількох місць, по всій поверхні якої роблять зскрібок та вміщують отриманий зразок в пробірку ємністю 2 мл, що містить 0,75 мл фармакопейного стерильного 0,9 % розчину натрію хлориду.

Спосіб виявлення днк патогенних лептоспір роду leptospira, виду leptospira interrogans у клінічному і патологічному матеріалі та зразках води

Завантаження...

Номер патенту: 94104

Опубліковано: 27.10.2014

Автори: Пискун Антон Володимирович, Скалига Марина Леонідівна, Кучерявенко Олександр Олександрович, Уховський Віталій Вікторович, Куликова Влада Вячеславівна

МПК: C12N 1/00

Мітки: клінічному, виявлення, патологічному, interrogans, роду, матеріали, виду, лептоспір, спосіб, зразках, патогенних, днк, води, leptospira

Формула / Реферат:

Спосіб виявлення ДНК патогенних лептоспір роду Leptospira, виду Leptospira interrogans у клінічному і патологічному матеріалі та зразках води, який здійснюють за допомогою специфічних олігонуклеотидних праймерів Lepto, що кодують специфічні ділянки гена мембранного протеїну Lip L 32 довжиною 264 пари нуклеотидних залишків, використовуючи полімеразну ланцюгову реакцію - ПЛР, яка включає наступні стадії: екстракцію ДНК із досліджуваних...

Спосіб визначення днк культур lactococcus lactis subsp. lactic та lactococcus lactis subsp. cremoris методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 105310

Опубліковано: 25.04.2014

Автори: Семенівська Олена Анатоліївна, Вакуленко Микола Михайлович, Малова Валерія Всеволодівна

МПК: C12N 15/09

Мітки: реакції, методом, lactococcus, lactic, визначення, lactis, ланцюгової, subsp, днк, спосіб, полімеразної, культур, cremoris

Формула / Реферат:

Спосіб визначення ДНК культур Lactococcus lactis subsp. lactic та Lactococcus lactis subsp. cremoris у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції, які відрізняються тим, що для визначення ДНК культур Lactococcus lactis subsp. lactis та Lactococcus lactis subsp. cremoris, застосовують пари олігонуклеотидних праймерів до гену recN...