Патенти з міткою «днк»

Спосіб контролю денатурації днк при використанні електрофорезу у поліакриламідному гелі

Завантаження...

Номер патенту: 123147

Опубліковано: 12.02.2018

Автори: Кулібаба Роман Олександрович, Юрко Поліна Сергіївна, Ляшенко Юрій Володимирович

МПК: G01N 33/483

Мітки: днк, спосіб, електрофорезу, денатурації, поліакриламідному, контролю, використанні, гелі

Формула / Реферат:

Спосіб контролю денатурації ДНК при використанні електрофорезу у поліакриламідному гелі застосовується шляхом проведення електрофоретичного розподілу у денатуруючому поліакриламідному гелі ампліфікованих мікросателітних локусів, який відрізняється тим, що додатково до дослідних проб у кожному гелі використовують контрольний зразок, який містить ампліфікований цільовий фрагмент ядерної ДНК гомозиготної особини виду Gallus gallus, що містить у...

Спосіб індикації днк бактерії chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 123070

Опубліковано: 12.02.2018

Автори: Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович

МПК: C12R 1/01, C12Q 1/68, A61K 39/118 ...

Мітки: chlamydia, бактерії, диференціації, ланцюговий, момр, полімеразній, avium, днк, індикації, фрагменту, видової, головного, реакції, білка, шляхом, гена, спосіб, ампліфікації, мембрани

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia avium здійснюють за допомогою пари праймерів: прямого: ChAvMOMPL: 5' - TTCTGGTGATCCTTGCGACC-3' та зворотного: ChAvMOMPR: 5'- GCTCCTAAAGTTGCACAACC - 3', з одержанням...

Спосіб введення молекули чужорідної днк в попередньо визначений сайт в геномі рослинної клітини

Завантаження...

Номер патенту: 115961

Опубліковано: 25.01.2018

Автор: БАЙЄР КРОПСАЄНС НВ

МПК: C12N 15/82

Мітки: рослинної, введення, визначений, сайт, клітині, попередньо, днк, чужорідної, спосіб, молекули, геномі

Формула / Реферат:

1. Спосіб введення молекули чужорідної ДНК в попередньо визначений сайт в геномі рослинної клітини, який включає етапи:а) індукування двонитчастого розриву ДНК в попередньо визначеному сайті;b) введення вказаної молекули чужорідної ДНК у вказану рослинну клітину; іс) відбору рослинної клітини, в якій вказана чужорідна ДНК є введеною у вказаний попередньо визначений сайт;який відрізняється тим, що вказаним...

Рекомбінантна молекула днк, яка вказує на присутність трансгенної події mon 87427 маїсу

Завантаження...

Номер патенту: 115762

Опубліковано: 26.12.2017

Автори: Ередіа Оскар, Хуан Цзиньтай, Фонсека Агустін Е., Стекер Мартін А., Келлі Ребекка А., Гарнаат Карл У., Фен Пол К.К., Ци Юлінь

МПК: C12N 15/29, A01H 5/00, C12N 15/82 ...

Мітки: масу, вказує, днк, 87427, яка, трансгенної, присутність, рекомбінантна, молекула, події

Формула / Реферат:

1. Рекомбінантна молекула ДНК, яка містить нуклеотидну послідовність, вибрану з групи, яка складається з SEQ ID NO: 1-8 і SEQ ID NO: 10, де вказана рекомбінантна молекула ДНК вказує на присутність події MON 87427, де вказана подія MON 87427 має нуклеотидну послідовність SEQ ID NO: 10, яка містить трансген, вбудований в геномну ДНК маїсу, і ділянки геномної ДНК маїсу, фланкуючі 3'- і 5'-кінці трансгенної вставки, де SEQ ID NO:...

Рекомбінантна молекула днк, яка вказує на присутність трансгенного об’єкта сої mon 87708

Завантаження...

Номер патенту: 115761

Опубліковано: 26.12.2017

Автори: Хой Шио-Вай, Ву Куншенг, Брінкер Рональд Дж., Гупта Анджу, Бернс Уен К., Фен Пол. С.С., Малвен Маріанне

МПК: C12N 15/82, C12N 15/29, A01H 5/00 ...

Мітки: сої, молекула, 87708, об'єкта, яка, вказує, рекомбінантна, присутність, трансгенного, днк

Формула / Реферат:

1. Рекомбінантна молекула ДНК, що містить нуклеотидну молекулу, яка містить нуклеотидну послідовність, вибрану з групи, яка складається з SEQ ID NO: 1-4 і 6-8 і комплементарних їм послідовностей, де вказана рекомбінантна молекула ДНК вказує на присутність трансгенного об'єкта MON 87708 і надавану тим самим наявність стійкості до дикамби, де вказаний трансгенний об’єкт MON 87708 має нуклеотидну послідовність SEQ ID NO: 6, яка містить...

Синтетична послідовність днк для експресії білка в клітинах кукурудзи та спосіб її застосування

Завантаження...

Номер патенту: 115526

Опубліковано: 27.11.2017

Автори: Редді Авуту С., Тхірумалаісвамісекхар Арвінд Кумар, Вуслі Ерон Тод, Ларрінуа Ігнасіо Маріо, Мерло Дональд Дж.

МПК: C12N 15/82, C12N 5/04, C12N 5/10 ...

Мітки: спосіб, клітинах, білка, експресії, синтетична, днк, застосування, послідовність, кукурудзи

Формула / Реферат:

1. Синтетична послідовність ДНК для експресії білка, який представляє інтерес, в клітинах кукурудзи, яка містить:a) оптимізовану по кодонах послідовність ДНК, яка кодує білок, який представляє інтерес,b) щонайменше одну послідовність сигналу поліаденілювання, вибрану із групи, яка складається із класу I і класу II, де:клас I вибирають із групи, яка складається із AATAAA, AATAAT, AACCAA, ATATAA, AATCAA, ATACTA, ATAAAA,...

Спосіб виявлення дезоксирибонуклеїнової кислоти (днк) бактерій cronobacter spp. (enterobacter sakazakii)

Завантаження...

Номер патенту: 118844

Опубліковано: 28.08.2017

Автори: Коростіль Сергій Олексійович, Моня Юлія Іванівна, Касянчук Вікторія Вікторівна, Дерябін Олег Миколайович, Терьохіна Олена Вікторівна, Бергілевич Олександра Миколаївна

МПК: C12R 1/01, C12Q 1/68

Мітки: enterobacter, днк, бактерій, cronobacter, виявлення, дезоксирибонуклеїнової, кислоти, sakazakii, спосіб

Формула / Реферат:

Спосіб виявлення дезоксирибонуклеїнової кислоти (ДНК) бактерій Cronobacter spp. (Enterobacter sakazakii), що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) за допомогою мультиплексного варіанту полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно синтезовані олігонуклеотидні праймери, які є специфічними фрагментами до гену 16S rRNA, з наступною...

Спосіб індикації днк бактерії chlamydia pneumoniae у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 117492

Опубліковано: 26.06.2017

Автори: Ксьонз Ігор Миколайович, Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович

МПК: A61K 39/118

Мітки: chlamydia, видової, ланцюговий, бактерії, pneumoniae, шляхом, фрагмента, гена, індикації, момр, мембрани, реакції, спосіб, головного, білка, днк, полімеразній, ампліфікації, диференціації

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia рnеumoniae у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia рnеumoniae здійснюють за допомогою пари праймерів: прямого: ChPnMOMPL: 5'-GGAACAAAGTCTGCGACCAT-3' та зворотного: ChPnMOMPR: 5'-AAAGAAGGGTTCCATGCAGTT-3', з...

Спосіб індикації днк бактерії chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117100

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: C12Q 1/68, C12R 1/01

Мітки: фрагмента, реакції, ланцюговий, білка, момp, ампліфікації, видової, диференціації, мембрани, chlamydia, шляхом, бактерії, головного, індикації, полімеразній, гена, спосіб, pecorum, днк

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia pecorum здійснюють за допомогою пари праймерів: прямого: ChPecMOMPL 5'-TCCAATACGCACAATCGAAA-3' та зворотного: ChPecMOMPR 5'-GTAAGACAACGCTGCACCAA-3', з одержанням...

Спосіб індикації днк бактерії chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117099

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: C12Q 1/68, C12R 1/01

Мітки: диференціації, головного, білка, індикації, ланцюговий, гена, мембрани, chlamydia, шляхом, реакції, полімеразній, днк, видової, момp, ампліфікації, спосіб, бактерії, фрагмента

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia suis здійснюють за допомогою пари праймерів: прямого: ChSuMOMPL: 5'- TTCTTTGCAATGCTGCTGAA-3' та зворотного: ChSuMOMPR: 5'- ATCAAAGCTTGCTCGAGACC-3', з одержанням...

Спосіб індикації днк бактерії chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 117097

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: C12R 1/01, C12Q 1/68

Мітки: днк, фрагмента, білка, полімеразній, гена, головного, спосіб, мембрани, шляхом, chlamydia, видової, реакції, ампліфікації, диференціації, psittaci, бактерії, індикації, ланцюговий, момр

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia psittaci здійснюють за допомогою пари праймерів: прямого: ChPsMOMPL: 5'-GCACTATGTGGGAAGGTGCT-3' та зворотного: ChPsMOMPR: 5'-CCATTTGCTTCTGGCTGATT-3', з одержанням...

Спосіб індикації днк бактерії chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117091

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: C12Q 1/68, C12R 1/01

Мітки: головного, ампліфікації, днк, індикації, шляхом, ланцюговий, момp, фрагмента, диференціації, гена, полімеразній, chlamydia, видової, мембрани, білка, спосіб, бактерії, abortus, реакції

Формула / Реферат:

Спосіб індикації ДНК бактерій Chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР) для її видової диференціації, який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia abortus здійснюють за допомогою пари праймерів: прямого: ChAbMOMPL: 5'-GGATAGACCCAACATCGCTT-3' та зворотного: ChAbMOMPR:...

Спосіб виділення дезоксирибонуклеїнової кислоти (днк) з тканини злоякісної пухлини щитоподібної залози, що фіксована в формальдегіді та поміщена у парафіновий блок

Завантаження...

Номер патенту: 114665

Опубліковано: 10.03.2017

Автори: Храпач Василь Васильович, Мішалов Володимир Григорович, Сулік Володимир Володимирович, Мелоян Ані Робертовна, Дінець Андрій Володимирович

МПК: C12N 15/00

Мітки: спосіб, тканини, блок, парафіновий, злоякісної, залози, фіксована, щитоподібної, поміщена, кислоти, виділення, дезоксирибонуклеїнової, днк, пухлини, формальдегіді

Формула / Реферат:

Спосіб виділення дезоксирибонуклеїнової кислоти (ДНК) з тканини злоякісної пухлини щитоподібної залози, що фіксована в формальдегіді та заключна у парафін, що включає депарафінізацію тканини ксилолом інкубацією при кімнатній температурі (21-22 °C), який відрізняється тим, що попередньо перед етапом депарафінізації тканину обробляють мінеральною олією і проводять інкубацію протягом 20 хвилин при температурі 90 °C далі проводять...

Спосіб видалення ділянки днк в рослині

Завантаження...

Номер патенту: 113493

Опубліковано: 10.02.2017

Автори: Петоліно Джозеф Ф., Расел Шон

МПК: C12N 15/29, A01H 1/02, A01H 5/00 ...

Мітки: рослини, днк, видалення, спосіб, ділянки

Формула / Реферат:

1. Спосіб видалення ділянки ДНК в рослині, згідно з яким:надають першу життєздатну рослину, що містить геномну ДНК, де геномна ДНК містить ділянку ДНК і першу послідовність розпізнавання, що фланкує 3'-кінець, і другу послідовність розпізнавання, що фланкує 5'-кінець ділянки ДНК, де перша послідовність розпізнавання і друга послідовність розпізнавання ідентичні;вводять ДНК, яка кодує нуклеазу "цинкові пальці" у другу...

Трансгенна рослина, що містить днк, яка кодує інсектицидний білок сry1be, і днк, яка кодує інсектицидний білок сry1fa, для боротьби або попередження виникнення стійкості у spodoptera frugiperda та ostrinia nubilalis

Завантаження...

Номер патенту: 113385

Опубліковано: 25.01.2017

Автори: Бертон Стефані Л., Сторер Ніколас П., Нарва Кеннет, Мід Томас, Шитс Джоел Дж., Вуслі Аарон Т.

МПК: A01N 63/02, A01H 5/10, A01H 5/00 ...

Мітки: виникнення, сry1fa, frugiperda, попередження, містить, білок, боротьби, рослина, ostrinia, яка, сry1be, spodoptera, кодує, трансгенна, nubilalis, днк, стійкості, інсектицидний

Формула / Реферат:

1. Трансгенна рослина, що містить ДНК, яка кодує інсектицидний білок Cry1Be, і ДНК, яка кодує інсектицидний білок Cry1Fa, де вказаний інсектицидний білок Cry1Fa щонайменше на 99 % ідентичний SEQ ID NO:1, і вказаний інсектицидний білок Cry1Be щонайменше на 99 % ідентичний SEQ ID NO:2, де вказаний інсектицидний білок Cry1Fa і вказаний інсектицидний білок Cry1Be мають різні ділянки зв'язування з рецептором в кишечнику FAW або ECB.2....

Застосування активності ендогенної днкази для зниження вмісту днк

Завантаження...

Номер патенту: 113293

Опубліковано: 10.01.2017

Автори: Ворд Майкл, Ко Дуґлас, Гофман Кетрин

МПК: C12N 1/08, C12Q 1/25

Мітки: вмісту, днк, днкази, застосування, ендогенної, активності, зниження

Формула / Реферат:

1. Спосіб зниження вмісту ДНК у бульйоні, у якому культивували клітини-хазяїни, що є клітинами нитчастих грибів, який включає наступні етапи:коригування pH і/або температури бульйону, у якому культивували грибні клітини-хазяїни протягом щонайменше 24 годин, зі збільшенням pH і/або температури, застосовуваних у культивуванні; таінкубування бульйону при збільшених pH та/або температурі протягом періоду, достатнього для зниження...

Трансгенна рослина, яка містить днк, що кодує і експресує інсектицидний білок cry1da, і днк, що кодує і експресує інсектицидний білок cry1fa, для боротьби з совкою трав’яною

Завантаження...

Номер патенту: 113273

Опубліковано: 10.01.2017

Автори: Мід Томас, Вуслі Ерон Т., Шитс Джоел Дж., Нарва Кенет, Бертон Стефані Л., Сторер Ніколас П.

МПК: A01N 63/02, A01H 5/10, A01H 5/00 ...

Мітки: cry1da, боротьби, cry1fa, совкою, містить, трав'яною, яка, рослина, білок, днк, трансгенна, експресує, інсектицидний, кодує

Формула / Реферат:

1. Трансгенна рослина, яка містить ДНК, що кодує і експресує інсектицидний білок Cry1Da, і ДНК, що кодує і експресує інсектицидний білок Cry1Fa.2. Трансгенна насінина рослини за п. 1, яка містить ДНК, що кодує і експресує інсектицидний білок Cry1Da, і ДНК, що кодує і експресує інсектицидний білок Cry1Fa.3. Трансгенна рослина за п. 1, де ДНК, що кодує і експресує інсектицидний білок Cry1Da, і ДНК, що кодує і експресує...

Спосіб виявлення дезоксирибонуклеїнової кислоти (днк) шигатоксинпродукуючих бактерій е. coli (stec)

Завантаження...

Номер патенту: 112623

Опубліковано: 26.12.2016

Автори: Касянчук Вікторія Вікторівна, Дерябін Олег Миколайович, Бергілевич Олександра Миколаївна, Єфімова Ольга Миколаївна, Сміянов Владислав Анатолійович, Кустуров Володимир Борисович

МПК: G01N 1/00, A61K 39/108

Мітки: виявлення, спосіб, stec, днк, шигатоксинпродукуючих, бактерій, кислоти, дезоксирибонуклеїнової

Формула / Реферат:

Спосіб виявлення дезоксирибонуклеїнової кислоти (ДНК) шигатоксинпродукуючих бактерій E. coli (STEC), що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) за допомогою мультиплексного варіанта полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно синтезовані олігонуклеотидні праймери з наступною послідовністю нуклеотидів:для гена токсину stx2...

Трансгенна рослина, яка містить днк, що кодує білок cry1da, і днк, що кодує білок cry1ca, для керування стійкими комахами spodoptera frugiperda

Завантаження...

Номер патенту: 112409

Опубліковано: 12.09.2016

Автори: Вуслі Аарон Т., Шитс Джоел Дж., Мід Томас, Нарва Кеннет, Бертон Стефані Л., Сторер Ніколас П.

МПК: A01H 5/10, A01N 63/02, A01H 5/00 ...

Мітки: стійкими, днк, містить, білок, cry1da, cry1ca, керування, трансгенна, spodoptera, frugiperda, рослина, яка, кодує, комахами

Формула / Реферат:

1. Трансгенна рослина, яка містить ДНК, що кодує білок Cry1Da, який має інсектицидну дію, і ДНК, що кодує білок Сrу1Са, який має інсектицидну дію.2. Трансгенна рослина за п. 1, де вказана рослина додатково містить ДНК, що кодує третій білок, який має інсектицидну дію, при цьому вказаний третій білок вибирають із групи, яка складається з Cry1Fa, Vip3Ab, Cry1Be i Cry1E.3. Трансгенна рослина за п. 2, де вказаний третій білок, який...

Трансгенна рослина, що містить днк, яка кодує інсектицидний білок cry1cа та cry1аb для боротьби з лускокрилими шкідниками

Завантаження...

Номер патенту: 112287

Опубліковано: 25.08.2016

Автори: Нарва Кеннет, Вуслі Аарон Т., Шитс Джоел Дж., Бертон Стефані Л., Мід Томас, Сторер Ніколас П.

МПК: C07K 14/325, A01N 63/02, C12N 15/82 ...

Мітки: днк, cry1ab, лускокрилими, рослина, яка, білок, cry1ca, шкідниками, кодує, боротьби, інсектицидний, трансгенна, містить

Формула / Реферат:

1. Трансгенна рослина, що має стійкість до комах-шкідників кукурудзяної листової совки (FAW; Spodoptera frugiperda) і/або вогнівки цукрової тростини (SCB; Diatraea saccharalis), що містить ДНК, яка кодує інсектицидний білок Cry1Ca з послідовністю SEQ ID NO: 2, і ДНК, яка кодує інсектицидний білок Cry1Ab з послідовністю SEQ ID NO: 3; де вказану рослину вибирають з групи, що складається з кукурудзи, сої, цукрової тростини і бавовни.2....

Трансгенна рослина, яка містить днк, що кодує інсектицидний білок сry1ca, і днк, що кодує інсектицидний білок сry1fa, для вироблення резистентності до комах

Завантаження...

Номер патенту: 112156

Опубліковано: 10.08.2016

Автори: Сторер Ніколас П., Вуслі Аарон Т., Нарва Кеннет, Бертон Стефані Л., Мід Томас, Шитс Джоел Дж.

МПК: A01H 5/10, A01H 5/00, A01N 63/02 ...

Мітки: трансгенна, рослина, містить, білок, яка, кодує, сry1fa, вироблення, комах, сry1ca, резистентності, днк, інсектицидний

Формула / Реферат:

1. Трансгенна рослина, яка містить ДНК, що кодує інсектицидний білок Cry1Cа, і ДНК, що кодує інсектицидний білок Cry1Fа.2. Трансгенне насіння рослини за п. 1, яке містить ДНК, що кодує інсектицидний білок Cry1Cа, і ДНК, що кодує інсектицидний білок Cry1Fа.3. Трансгенна рослина за п. 1, де ДНК, що кодує інсектицидний білок Cry1Cа, і ДНК, що кодує інсектицидний білок Cry1Fа, були введені у вказану рослину шляхом інтрогресії....

Спосіб виділення дезоксирибонуклеїнової кислоти (днк) з парафінових гістологічних блоків

Завантаження...

Номер патенту: 108736

Опубліковано: 25.07.2016

Автори: Кузенко Євген Вікторович, Линдін Микола Сергійович, Романюк Анатолій Миколайович

МПК: C12N 15/10

Мітки: кислоти, блоків, дезоксирибонуклеїнової, парафінових, спосіб, виділення, гістологічних, днк

Формула / Реферат:

Спосіб виділення дезоксирибонуклеїнової кислоти (ДНК) з парафінових гістологічних блоків, що включає отримання на мікротомі парафінізованих зрізів тканин із парафінізованого зразка тканин, підготовку їх гістологічним методом, депарафінізацію гістологічних зрізів, розділення розчину з ДНК шляхом центрифугування з наступним його виділенням, який відрізняється тим, що депарафінізацію підготовлених гістологічних зрізів здійснюють при кімнатній...

Трансгенна рослина цукрової тростини, яка містить днк, що кодує інсектицидний білок cry1fa, і днк, що кодує інсектицидний білок cry1ab, для боротьби з вогнівкою цукрової тростини

Завантаження...

Номер патенту: 112056

Опубліковано: 25.07.2016

Автори: Сторер Ніколас П., Мід Томас, Бертон Стефані Л., Нарва Кеннет, Шитс Джоел Дж.

МПК: A01H 5/10, A01N 63/02, A01H 5/00 ...

Мітки: трансгенна, тростини, кодує, містить, яка, cry1fa, днк, cry1ab, вогнівкою, рослина, боротьби, білок, цукрової, інсектицидний

Формула / Реферат:

1. Трансгенна рослина цукрової тростини, яка містить ДНК, що кодує інсектицидний білок Cry1Fa, і ДНК, що кодує інсектицидний білок Cry1Ab.2. Трансгенна рослина цукрової тростини за п. 1, в якій ДНК, що кодує коровий токсиновмісний білок Cry1Fa, і ДНК, що кодує коровий токсиновмісний білок Cry1Ab, інтрогресовані у вказану рослину цукрової тростини.3. Частина трансгенної рослини за п. 1, яка містить ДНК, що кодує інсектицидний...

Трансгенна рослина, яка містить днк, що кодує інсектицидний білок vip3ab, і днк, що кодує інсектицидний білок cry1ca, для керування резистентністю комах

Завантаження...

Номер патенту: 111936

Опубліковано: 11.07.2016

Автори: Мід Томас, Бертон Стефані Л., Вуслі Аарон Т., Шитс Джоел Дж., Сторер Ніколас П., Нарва Кеннет

МПК: A01H 5/00, A01N 63/02, A01H 5/10 ...

Мітки: комах, трансгенна, cry1ca, яка, кодує, містить, vip3ab, інсектицидний, рослина, керування, днк, білок, резистентністю

Формула / Реферат:

1. Трансгенна рослина, яка містить ДНК, що кодує білок Vip3Ab, який має інсектицидну дію, і ДНК, що кодує білок Cry1Сa, який має інсектицидну дію.2. Трансгенна рослина за п. 1, де вказана рослина додатково містить ДНК, що кодує третій білок, який має інсектицидну дію, при цьому вказаний третій білок вибирають з групи, що складається з Cry1Fa, Cry1Da, Cry1Be і Cry1E.3. Трансгенна рослина за п. 2, де вказаний третій білок...

Трансгенна рослина, яка містить днк, що кодує інсектицидний білок cry1ab, і днк, що кодує інсектицидний білок cry1be, для керування резистентністю комах

Завантаження...

Номер патенту: 111935

Опубліковано: 11.07.2016

Автори: Мід Томас, Сторер Ніколас П., Бертон Стефані Л., Нарва Кеннет, Шитс Джоел Дж., Вуслі Аарон Т.

МПК: A01H 5/10, A01H 5/00, A01N 63/02 ...

Мітки: резистентністю, рослина, кодує, комах, білок, трансгенна, cry1ab, cry1be, містить, яка, керування, днк, інсектицидний

Формула / Реферат:

1. Трансгенна рослина, яка містить ДНК, що кодує інсектицидний білок Cry1Ab, і ДНК, що кодує інсектицидний білок Cry1Be.2. Трансгенна рослина за п. 1, де вказана рослина додатково містить ДНК, що кодує третій інсектицидний білок, де вказаний третій білок вибраний з групи, що складається з Cry2A, Cry1I і DIG-3.3. Трансгенна рослина за п. 2, де вказана рослина додатково містить ДНК, що кодує інсектицидний білок Cry1Fa, і ДНК, що...

Трансгенна рослина, що містить днк, яка кодує інсектицидний білок vip3ab, і днк, яка кодує інсектицидний білок cry1fa, стійка до лускокрилих шкідників

Завантаження...

Номер патенту: 111934

Опубліковано: 11.07.2016

Автори: Нарва Кеннет, Вуслі Аарон Т., Сторер Ніколас П., Шитс Джоел Дж., Мід Томас, Бертон Стефані Л.

МПК: A01H 5/00, A01N 63/02, A01H 5/10 ...

Мітки: шкідників, лускокрилих, містить, кодує, яка, cry1fa, vip3ab, днк, інсектицидний, стійка, білок, рослина, трансгенна

Формула / Реферат:

1. Трансгенна рослина, що містить ДНК, яка кодує інсектицидний білок Vip3Ab, і ДНК, яка кодує інсектицидний білок Cry1Fa, де вказаний інсектицидний білок Cry1Fa є щонайменше на 95 % ідентичним SEQ ID NO:1, і вказаний інсектицидний білок Vip3Ab є щонайменше на 95 % ідентичним SEQ ID NO:2.2. Насінина рослини за п. 1, що містить ДНК, яка кодує інсектицидний білок Vip3Ab, і ДНК, яка кодує інсектицидний білок Cry1Fa.3....

Спосіб визначення днк бактерій виду chlamydia abortus, chlamydia pecorum, chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу р (rnase p rna)

Завантаження...

Номер патенту: 110546

Опубліковано: 12.01.2016

Автори: Цівенко Тетяна Михайлівна, Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: C12R 1/01, C12Q 1/68

Мітки: кодує, бактерій, rnase, полімеразній, гена, спосіб, фрагмента, реакції, визначення, pecorum, abortus, ланцюговий, chlamydia, ампліфікації, psittaci, днк, шляхом, виду, ендорибонуклеазу

Формула / Реферат:

Спосіб визначення ДНК бактерій виду Chlamydia abortus, Chlamydia pecorum, Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу Р (RNase Р RNA), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки фрагмента гена RNase Р RNA здійснюють за допомогою пари праймерів: прямого:CHCPF:5`-GGAGAAACTCCAGGGGCCGT-3` та зворотного:...

Спосіб виявлення днк yersinia enterocolitica за допомогою “напівгніздового” методу полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 103102

Опубліковано: 10.12.2015

Автори: Виговська Лілія Миколаївна, Поліщук Наталія Миколаївна, Дерябін Олег Миколайович, Ушкалов Артем Валерійович, Мачуський Олександр Вікторович, Головко Анатолій Миколаєвич

МПК: A61K 31/00, G01N 33/00, C12Q 1/00 ...

Мітки: полімеразної, напівгніздового, спосіб, виявлення, реакції, ланцюгової, enterocolitica, днк, допомогою, методу, yersinia

Формула / Реферат:

Спосіб виявлення ДНК бактерії YERSINIA ENTEROCOLITICA за допомогою полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) збудника за допомогою "напівгніздового" варіанта полімеразної ланцюгової реакції (ПЛР) - ферментативної реакції і трьох штучно синтезованих олігонуклеотидних праймерів, які дозволяють багаторазово копіювати специфічні ділянки ДНК...

Спосіб зниження інфекційних властивостей днк- та рнк-вмісних вірусів

Завантаження...

Номер патенту: 101429

Опубліковано: 10.09.2015

Автори: Клестова Зінаїда Сергіївна, Дгебуадзе Шота, Вороніна Алла Костянтинівна, Ташута Віктор Сергійович

МПК: A61K 45/00, A61P 31/14, A61D 99/00 ...

Мітки: властивостей, рнк-вмісних, днк, зниження, спосіб, вірусів, інфекційних

Формула / Реферат:

Спосіб зниження інфекційних властивостей ДНК- та РНК-вмісних вірусів, який відрізняється тим, що застосовують як інгібітор вірусів індолвмісну конденсовану тетрациклічну сполуку 3Н-бензофуро(2,3-f)-1,2,3-бензотриазолу, при цьому процес здійснюють у культурах клітин тваринного походження ВНK-21, СНЕВ та SK-6 за використання трьох схем застосування сполуки.

Спосіб визначення днк бактерій chlamydia felis у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр)

Завантаження...

Номер патенту: 109489

Опубліковано: 25.08.2015

Автори: Цівенко Тетяна Михайлівна, Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович

МПК: C12Q 1/68, C12R 1/01

Мітки: реакції, мембрани, визначення, момр, chlamydia, днк, шляхом, felis, спосіб, полімеразній, фрагменту, ланцюговий, бактерій, ампліфікації, білка, головного, гена

Формула / Реферат:

Спосіб визначення ДНК збудника хламідійних інфекцій домашніх котів у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки ДНК МОМР бактерії Chlamydia felis здійснюють з використанням пари праймерів: прямого CHFMF 5'-GCAGCTTCTGGAACTGCAAGC-3' та зворотного CHFMR 5'-GGCGАААТСAGTTCCTGCAAGА-3' з одержанням...

Спосіб виявлення днк патогенних лептоспір роду leptospira, виду leptospira interrogans у клінічному і патологічному матеріалі та зразках води за допомогою полімеразної ланцюгової реакції у режимі реального часу

Завантаження...

Номер патенту: 101190

Опубліковано: 25.08.2015

Автори: Куликова Влада Вячеславівна, Кучерявенко Олександр Олександрович, Уховський Віталій Вікторович

МПК: C07K 14/20

Мітки: води, полімеразної, leptospira, режимі, зразках, клінічному, патологічному, ланцюгової, допомогою, роду, матеріали, лептоспір, реакції, реального, виявлення, днк, часу, interrogans, виду, патогенних, спосіб

Формула / Реферат:

Спосіб виявлення ДНК патогенних лептоспір роду Leptospira, виду Leptospira interrogans у клінічному і патологічному матеріалі та зразках води за допомогою полімеразної ланцюгової реакції у реальному часі (ПЛР-РЧ), який здійснюють за допомогою специфічних фрагментів нуклеїнових кислот (ДНК) та гібридизаційно-флуоресценції детекції продуктів ампліфікації у режимі реального часу, який відрізняється тим, що результат ампліфікації ДНК патогенних...

Спосіб виявлення днк бактерії coxiella burnetii збудника ку-лихоманки за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 100232

Опубліковано: 10.07.2015

Автори: Дерябін Олег Миколайович, Неволько Олег Михайлович, Головко Анатолій Миколайович, Марущак Людмила Василівна

МПК: C12Q 1/68

Мітки: burnetii, ланцюгової, реакції, ку-лихоманки, виявлення, coxiella, бактерії, полімеразної, днк, спосіб, збудника, допомогою

Формула / Реферат:

Спосіб виявлення ДНК бактерії Coxiella burnetii збудника Ку-лихоманки за допомогою полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (НК) гену соm l, який кодує висококонсервативний білок зовнішньої мембрани з М.м 27kDа збудника Ку-лихоманки за допомогою полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно...

Спосіб отримання днк для полімеразно-ланцюгової реакції із тканин пухлини

Завантаження...

Номер патенту: 99734

Опубліковано: 25.06.2015

Автори: Малишева Тетяна Анатоліївна, Потапова Антоніна Ігнатіївна, Ключникова Антоніна Іванівна, Лісяний Олександр Миколайович, Лісяний Микола Іванович

МПК: C12N 15/00

Мітки: спосіб, днк, реакції, отримання, полімеразно-ланцюгової, тканин, пухлини

Формула / Реферат:

Спосіб отримання ДНК для полімеразно-ланцюгової реакції(ПЛР) із тканин пухлини, що є молекулярно-генетичним методом досліджень, який відрізняється тим, що для спрощення зберігання досліджуваних тканин та широкого і доступного використання методів на основі ПЛР, використовують фіксовані формаліном та заключні в парафін зразки різних тканин, в т.ч. пухлин людини, шляхом отримання із них гістологічних тонких зрізів товщиною до 10 нм, далі...

Спосіб визначення успадкування стійкості картоплі до раку synchytrium endobioticum (schilb) perc. плр аналізом днк

Завантаження...

Номер патенту: 99352

Опубліковано: 25.05.2015

Автори: Захарчук Наталья Анатолівна, Борзих Олександр Іванович, Фурдига Микола Миколайович, Олійник Тетяна Миколаївна, Козуб Наталія Олександрівна, Карелов Анатолій Валерійович, Зеля Аврелія Георгіївна, Гунчак Володимир Михайлович, Бондарчук Анатолій Андрійович, Зеля Георгій Віорелович, Пилипенко Лілія Амінівна

МПК: A01C 1/00

Мітки: успадкування, synchytrium, perc, визначення, плр, спосіб, schilb, днк, раку, endobioticum, стійкості, аналізом, картоплі

Формула / Реферат:

Спосіб визначення успадкування стійкості картоплі до раку Synchytrium endobioticum (Schilb) Perc, що включає зараження паростків картоплі літніми зооспорами збудника хвороби і їх аналіз, який відрізняється тим, що з вихідних батьківських форм картоплі, а також з гібридів, отриманих від комбінацій схрещування виділяють ДНК, проводять їх електрофорез в агарозному гелі і за виявленими продуктами ампліфікації ДНК ідентифікують сприйнятливі до...

Спосіб визначення днк культури lactococcus lactis subsp. lactis за допомогою специфічних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107897

Опубліковано: 25.02.2015

Автори: Жукова Ярослава Фрідріхівна, Малова Валерія Всеволодівна, Вакуленко Микола Михайлович, Король Цвітана Олександрівна, Науменко Оксана Василівна

МПК: C12N 15/00

Мітки: subsp, полімеразної, визначення, спосіб, lactis, методом, допомогою, днк, культури, специфічних, реакції, праймерів, ланцюгової, lactococcus

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. lactic за допомогою специфічних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культури Lactococcus lactis subsp. lactis, використовують пару олігонуклеотидних праймерів до гену асmА N-ацетилмурамідази:прямий...

Спосіб визначення днк культури lactococcus lactis subsp. cremoris методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107547

Опубліковано: 12.01.2015

Автори: Малова Валерія Всеволодівна, Семенівська Олена Анатоліївна, Вакуленко Микола Михайлович

МПК: C12N 15/09

Мітки: cremoris, полімеразної, ланцюгової, lactococcus, днк, lactis, subsp, визначення, методом, спосіб, культури, реакції

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. cremoris у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції,який відрізняється тим, що для визначення ДНК культур Lactococcus lactis subsp. cremoris, застосовують пару олігонуклеотидних праймерів до гену recN DNA repair protein:прямий праймер

Спосіб визначення днк культури lactococcus lactis subsp. lactis методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107546

Опубліковано: 12.01.2015

Автори: Малова Валерія Всеволодівна, Вакуленко Микола Михайлович, Семенівська Олена Анатоліївна

МПК: C12N 15/09

Мітки: полімеразної, визначення, реакції, ланцюгової, lactococcus, методом, днк, спосіб, культури, lactis, subsp

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. lactic у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції, який відрізняється тим, що для визначення ДНК культури Lactococcus lactis subsp. lactis застосовують пару олігонуклеотидних праймерів до гену recN DNA repair protein:прямий праймер recN F: 5'- CAGGCTGAAGAAATTGAAGC-3' 20 bp тазворотній праймер recN R: 5'-...

Спосіб отримання зразків тканини плаценти для подальшої діагностики днк збудників урогенітальних інфекцій методом полімеразно-ланцюгової реакції

Завантаження...

Номер патенту: 95219

Опубліковано: 10.12.2014

Автори: Лобинцева Галина Степанівна, В'ялих Жанна Едуардівна, Шаблій Володимир Анатолійович, Мартиненко Сергій Іванович, Покас Олена Вікторівна, Ціленко Лариса Миколаївна, Задорожна Вікторія Іванівна, Вихристюк Ірина Олександрівна, Приходько Тетяна Олександрівна, Бойко Оксана Іванівна, Безкоровайна Лілія Володимирівна

МПК: A61B 10/00, G01N 33/48

Мітки: тканини, отримання, полімеразно-ланцюгової, урогенітальних, плаценти, збудникiв, методом, подальшої, зразків, діагностики, днк, спосіб, реакції, інфекцій

Формула / Реферат:

Спосіб отримання зразків тканини плаценти для подальшої діагностики ДНК збудників урогенітальних інфекцій, що включає відбір зразка для досліджень, який відрізняється тим, що знімають амніотичну оболонку з плаценти з декількох місць, по всій поверхні якої роблять зскрібок та вміщують отриманий зразок в пробірку ємністю 2 мл, що містить 0,75 мл фармакопейного стерильного 0,9 % розчину натрію хлориду.

Спосіб виявлення днк патогенних лептоспір роду leptospira, виду leptospira interrogans у клінічному і патологічному матеріалі та зразках води

Завантаження...

Номер патенту: 94104

Опубліковано: 27.10.2014

Автори: Скалига Марина Леонідівна, Кучерявенко Олександр Олександрович, Уховський Віталій Вікторович, Куликова Влада Вячеславівна, Пискун Антон Володимирович

МПК: C12N 1/00

Мітки: interrogans, роду, виду, патогенних, матеріали, лептоспір, патологічному, клінічному, води, виявлення, днк, спосіб, leptospira, зразках

Формула / Реферат:

Спосіб виявлення ДНК патогенних лептоспір роду Leptospira, виду Leptospira interrogans у клінічному і патологічному матеріалі та зразках води, який здійснюють за допомогою специфічних олігонуклеотидних праймерів Lepto, що кодують специфічні ділянки гена мембранного протеїну Lip L 32 довжиною 264 пари нуклеотидних залишків, використовуючи полімеразну ланцюгову реакцію - ПЛР, яка включає наступні стадії: екстракцію ДНК із досліджуваних...

Спосіб визначення днк культур lactococcus lactis subsp. lactic та lactococcus lactis subsp. cremoris методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 105310

Опубліковано: 25.04.2014

Автори: Семенівська Олена Анатоліївна, Малова Валерія Всеволодівна, Вакуленко Микола Михайлович

МПК: C12N 15/09

Мітки: спосіб, полімеразної, днк, реакції, lactis, lactic, subsp, визначення, культур, ланцюгової, cremoris, lactococcus, методом

Формула / Реферат:

Спосіб визначення ДНК культур Lactococcus lactis subsp. lactic та Lactococcus lactis subsp. cremoris у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції, які відрізняються тим, що для визначення ДНК культур Lactococcus lactis subsp. lactis та Lactococcus lactis subsp. cremoris, застосовують пари олігонуклеотидних праймерів до гену recN...