Патенти з міткою «днк»

Спосіб контролю денатурації днк при використанні електрофорезу у поліакриламідному гелі

Завантаження...

Номер патенту: 123147

Опубліковано: 12.02.2018

Автори: Кулібаба Роман Олександрович, Ляшенко Юрій Володимирович, Юрко Поліна Сергіївна

МПК: G01N 33/483

Мітки: поліакриламідному, контролю, денатурації, днк, використанні, електрофорезу, гелі, спосіб

Формула / Реферат:

Спосіб контролю денатурації ДНК при використанні електрофорезу у поліакриламідному гелі застосовується шляхом проведення електрофоретичного розподілу у денатуруючому поліакриламідному гелі ампліфікованих мікросателітних локусів, який відрізняється тим, що додатково до дослідних проб у кожному гелі використовують контрольний зразок, який містить ампліфікований цільовий фрагмент ядерної ДНК гомозиготної особини виду Gallus gallus, що містить у...

Спосіб індикації днк бактерії chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 123070

Опубліковано: 12.02.2018

Автори: Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна

МПК: A61K 39/118, C12R 1/01, C12Q 1/68 ...

Мітки: білка, avium, реакції, момр, головного, видової, chlamydia, гена, бактерії, індикації, диференціації, спосіб, мембрани, ланцюговий, полімеразній, шляхом, фрагменту, ампліфікації, днк

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia avium у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia avium здійснюють за допомогою пари праймерів: прямого: ChAvMOMPL: 5' - TTCTGGTGATCCTTGCGACC-3' та зворотного: ChAvMOMPR: 5'- GCTCCTAAAGTTGCACAACC - 3', з одержанням...

Спосіб введення молекули чужорідної днк в попередньо визначений сайт в геномі рослинної клітини

Завантаження...

Номер патенту: 115961

Опубліковано: 25.01.2018

Автор: БАЙЄР КРОПСАЄНС НВ

МПК: C12N 15/82

Мітки: геномі, рослинної, днк, спосіб, сайт, молекули, чужорідної, попередньо, клітині, введення, визначений

Формула / Реферат:

1. Спосіб введення молекули чужорідної ДНК в попередньо визначений сайт в геномі рослинної клітини, який включає етапи:а) індукування двонитчастого розриву ДНК в попередньо визначеному сайті;b) введення вказаної молекули чужорідної ДНК у вказану рослинну клітину; іс) відбору рослинної клітини, в якій вказана чужорідна ДНК є введеною у вказаний попередньо визначений сайт;який відрізняється тим, що вказаним...

Рекомбінантна молекула днк, яка вказує на присутність трансгенної події mon 87427 маїсу

Завантаження...

Номер патенту: 115762

Опубліковано: 26.12.2017

Автори: Стекер Мартін А., Ци Юлінь, Ередіа Оскар, Фонсека Агустін Е., Хуан Цзиньтай, Гарнаат Карл У., Фен Пол К.К., Келлі Ребекка А.

МПК: C12N 15/82, A01H 5/00, C12N 15/29 ...

Мітки: днк, трансгенної, рекомбінантна, події, 87427, масу, вказує, присутність, молекула, яка

Формула / Реферат:

1. Рекомбінантна молекула ДНК, яка містить нуклеотидну послідовність, вибрану з групи, яка складається з SEQ ID NO: 1-8 і SEQ ID NO: 10, де вказана рекомбінантна молекула ДНК вказує на присутність події MON 87427, де вказана подія MON 87427 має нуклеотидну послідовність SEQ ID NO: 10, яка містить трансген, вбудований в геномну ДНК маїсу, і ділянки геномної ДНК маїсу, фланкуючі 3'- і 5'-кінці трансгенної вставки, де SEQ ID NO:...

Рекомбінантна молекула днк, яка вказує на присутність трансгенного об’єкта сої mon 87708

Завантаження...

Номер патенту: 115761

Опубліковано: 26.12.2017

Автори: Ву Куншенг, Брінкер Рональд Дж., Фен Пол. С.С., Хой Шио-Вай, Малвен Маріанне, Бернс Уен К., Гупта Анджу

МПК: C12N 15/82, A01H 5/00, C12N 15/29 ...

Мітки: днк, 87708, яка, вказує, сої, рекомбінантна, трансгенного, присутність, об'єкта, молекула

Формула / Реферат:

1. Рекомбінантна молекула ДНК, що містить нуклеотидну молекулу, яка містить нуклеотидну послідовність, вибрану з групи, яка складається з SEQ ID NO: 1-4 і 6-8 і комплементарних їм послідовностей, де вказана рекомбінантна молекула ДНК вказує на присутність трансгенного об'єкта MON 87708 і надавану тим самим наявність стійкості до дикамби, де вказаний трансгенний об’єкт MON 87708 має нуклеотидну послідовність SEQ ID NO: 6, яка містить...

Синтетична послідовність днк для експресії білка в клітинах кукурудзи та спосіб її застосування

Завантаження...

Номер патенту: 115526

Опубліковано: 27.11.2017

Автори: Ларрінуа Ігнасіо Маріо, Редді Авуту С., Мерло Дональд Дж., Тхірумалаісвамісекхар Арвінд Кумар, Вуслі Ерон Тод

МПК: C12N 15/82, C12N 5/10, C12N 5/04 ...

Мітки: застосування, кукурудзи, білка, послідовність, днк, синтетична, спосіб, клітинах, експресії

Формула / Реферат:

1. Синтетична послідовність ДНК для експресії білка, який представляє інтерес, в клітинах кукурудзи, яка містить:a) оптимізовану по кодонах послідовність ДНК, яка кодує білок, який представляє інтерес,b) щонайменше одну послідовність сигналу поліаденілювання, вибрану із групи, яка складається із класу I і класу II, де:клас I вибирають із групи, яка складається із AATAAA, AATAAT, AACCAA, ATATAA, AATCAA, ATACTA, ATAAAA,...

Спосіб виявлення дезоксирибонуклеїнової кислоти (днк) бактерій cronobacter spp. (enterobacter sakazakii)

Завантаження...

Номер патенту: 118844

Опубліковано: 28.08.2017

Автори: Бергілевич Олександра Миколаївна, Касянчук Вікторія Вікторівна, Терьохіна Олена Вікторівна, Дерябін Олег Миколайович, Моня Юлія Іванівна, Коростіль Сергій Олексійович

МПК: C12Q 1/68, C12R 1/01

Мітки: днк, дезоксирибонуклеїнової, виявлення, cronobacter, бактерій, sakazakii, кислоти, спосіб, enterobacter

Формула / Реферат:

Спосіб виявлення дезоксирибонуклеїнової кислоти (ДНК) бактерій Cronobacter spp. (Enterobacter sakazakii), що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) за допомогою мультиплексного варіанту полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно синтезовані олігонуклеотидні праймери, які є специфічними фрагментами до гену 16S rRNA, з наступною...

Спосіб індикації днк бактерії chlamydia pneumoniae у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 117492

Опубліковано: 26.06.2017

Автори: Ксьонз Ігор Миколайович, Корнієнко Марина Володимирівна, Почерняєв Костянтин Федорович

МПК: A61K 39/118

Мітки: диференціації, момр, ланцюговий, індикації, ампліфікації, білка, реакції, видової, мембрани, гена, pneumoniae, шляхом, днк, фрагмента, головного, chlamydia, полімеразній, спосіб, бактерії

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia рnеumoniae у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia рnеumoniae здійснюють за допомогою пари праймерів: прямого: ChPnMOMPL: 5'-GGAACAAAGTCTGCGACCAT-3' та зворотного: ChPnMOMPR: 5'-AAAGAAGGGTTCCATGCAGTT-3', з...

Спосіб індикації днк бактерії chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117100

Опубліковано: 12.06.2017

Автори: Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович

МПК: C12R 1/01, C12Q 1/68

Мітки: мембрани, chlamydia, момp, гена, днк, шляхом, головного, індикації, білка, бактерії, pecorum, полімеразній, фрагмента, диференціації, ампліфікації, видової, ланцюговий, реакції, спосіб

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia pecorum у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia pecorum здійснюють за допомогою пари праймерів: прямого: ChPecMOMPL 5'-TCCAATACGCACAATCGAAA-3' та зворотного: ChPecMOMPR 5'-GTAAGACAACGCTGCACCAA-3', з одержанням...

Спосіб індикації днк бактерії chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117099

Опубліковано: 12.06.2017

Автори: Почерняєв Костянтин Федорович, Ксьонз Ігор Миколайович, Корнієнко Марина Володимирівна

МПК: C12R 1/01, C12Q 1/68

Мітки: ланцюговий, chlamydia, головного, днк, бактерії, шляхом, білка, полімеразній, фрагмента, диференціації, мембрани, момp, видової, гена, індикації, ампліфікації, спосіб, реакції

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia suis у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia suis здійснюють за допомогою пари праймерів: прямого: ChSuMOMPL: 5'- TTCTTTGCAATGCTGCTGAA-3' та зворотного: ChSuMOMPR: 5'- ATCAAAGCTTGCTCGAGACC-3', з одержанням...

Спосіб індикації днк бактерії chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момр) для її видової диференціації

Завантаження...

Номер патенту: 117097

Опубліковано: 12.06.2017

Автори: Почерняєв Костянтин Федорович, Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович

МПК: C12Q 1/68, C12R 1/01

Мітки: головного, ампліфікації, фрагмента, індикації, гена, полімеразній, ланцюговий, момр, спосіб, днк, білка, chlamydia, диференціації, шляхом, psittaci, мембрани, бактерії, реакції, видової

Формула / Реферат:

Спосіб визначення ДНК бактерій Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia psittaci здійснюють за допомогою пари праймерів: прямого: ChPsMOMPL: 5'-GCACTATGTGGGAAGGTGCT-3' та зворотного: ChPsMOMPR: 5'-CCATTTGCTTCTGGCTGATT-3', з одержанням...

Спосіб індикації днк бактерії chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (момp) для її видової диференціації

Завантаження...

Номер патенту: 117091

Опубліковано: 12.06.2017

Автори: Корнієнко Марина Володимирівна, Ксьонз Ігор Миколайович, Почерняєв Костянтин Федорович

МПК: C12R 1/01, C12Q 1/68

Мітки: бактерії, гена, ампліфікації, реакції, диференціації, видової, chlamydia, ланцюговий, полімеразній, фрагмента, шляхом, білка, спосіб, індикації, головного, днк, abortus, момp, мембрани

Формула / Реферат:

Спосіб індикації ДНК бактерій Chlamydia abortus у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена головного білка мембрани (МОМР) для її видової диференціації, який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки означеного фрагмента гена МОМР Chlamydia abortus здійснюють за допомогою пари праймерів: прямого: ChAbMOMPL: 5'-GGATAGACCCAACATCGCTT-3' та зворотного: ChAbMOMPR:...

Спосіб виділення дезоксирибонуклеїнової кислоти (днк) з тканини злоякісної пухлини щитоподібної залози, що фіксована в формальдегіді та поміщена у парафіновий блок

Завантаження...

Номер патенту: 114665

Опубліковано: 10.03.2017

Автори: Храпач Василь Васильович, Сулік Володимир Володимирович, Дінець Андрій Володимирович, Мішалов Володимир Григорович, Мелоян Ані Робертовна

МПК: C12N 15/00

Мітки: формальдегіді, дезоксирибонуклеїнової, блок, виділення, залози, днк, тканини, пухлини, злоякісної, парафіновий, спосіб, щитоподібної, фіксована, поміщена, кислоти

Формула / Реферат:

Спосіб виділення дезоксирибонуклеїнової кислоти (ДНК) з тканини злоякісної пухлини щитоподібної залози, що фіксована в формальдегіді та заключна у парафін, що включає депарафінізацію тканини ксилолом інкубацією при кімнатній температурі (21-22 °C), який відрізняється тим, що попередньо перед етапом депарафінізації тканину обробляють мінеральною олією і проводять інкубацію протягом 20 хвилин при температурі 90 °C далі проводять...

Спосіб видалення ділянки днк в рослині

Завантаження...

Номер патенту: 113493

Опубліковано: 10.02.2017

Автори: Расел Шон, Петоліно Джозеф Ф.

МПК: A01H 5/00, C12N 15/29, A01H 1/02 ...

Мітки: днк, спосіб, ділянки, рослини, видалення

Формула / Реферат:

1. Спосіб видалення ділянки ДНК в рослині, згідно з яким:надають першу життєздатну рослину, що містить геномну ДНК, де геномна ДНК містить ділянку ДНК і першу послідовність розпізнавання, що фланкує 3'-кінець, і другу послідовність розпізнавання, що фланкує 5'-кінець ділянки ДНК, де перша послідовність розпізнавання і друга послідовність розпізнавання ідентичні;вводять ДНК, яка кодує нуклеазу "цинкові пальці" у другу...

Трансгенна рослина, що містить днк, яка кодує інсектицидний білок сry1be, і днк, яка кодує інсектицидний білок сry1fa, для боротьби або попередження виникнення стійкості у spodoptera frugiperda та ostrinia nubilalis

Завантаження...

Номер патенту: 113385

Опубліковано: 25.01.2017

Автори: Вуслі Аарон Т., Бертон Стефані Л., Нарва Кеннет, Шитс Джоел Дж., Сторер Ніколас П., Мід Томас

МПК: A01H 5/00, A01H 5/10, A01N 63/02 ...

Мітки: містить, інсектицидний, nubilalis, кодує, spodoptera, попередження, сry1be, яка, днк, білок, сry1fa, боротьби, рослина, трансгенна, ostrinia, стійкості, frugiperda, виникнення

Формула / Реферат:

1. Трансгенна рослина, що містить ДНК, яка кодує інсектицидний білок Cry1Be, і ДНК, яка кодує інсектицидний білок Cry1Fa, де вказаний інсектицидний білок Cry1Fa щонайменше на 99 % ідентичний SEQ ID NO:1, і вказаний інсектицидний білок Cry1Be щонайменше на 99 % ідентичний SEQ ID NO:2, де вказаний інсектицидний білок Cry1Fa і вказаний інсектицидний білок Cry1Be мають різні ділянки зв'язування з рецептором в кишечнику FAW або ECB.2....

Застосування активності ендогенної днкази для зниження вмісту днк

Завантаження...

Номер патенту: 113293

Опубліковано: 10.01.2017

Автори: Ворд Майкл, Гофман Кетрин, Ко Дуґлас

МПК: C12N 1/08, C12Q 1/25

Мітки: вмісту, днк, зниження, ендогенної, днкази, застосування, активності

Формула / Реферат:

1. Спосіб зниження вмісту ДНК у бульйоні, у якому культивували клітини-хазяїни, що є клітинами нитчастих грибів, який включає наступні етапи:коригування pH і/або температури бульйону, у якому культивували грибні клітини-хазяїни протягом щонайменше 24 годин, зі збільшенням pH і/або температури, застосовуваних у культивуванні; таінкубування бульйону при збільшених pH та/або температурі протягом періоду, достатнього для зниження...

Трансгенна рослина, яка містить днк, що кодує і експресує інсектицидний білок cry1da, і днк, що кодує і експресує інсектицидний білок cry1fa, для боротьби з совкою трав’яною

Завантаження...

Номер патенту: 113273

Опубліковано: 10.01.2017

Автори: Бертон Стефані Л., Вуслі Ерон Т., Нарва Кенет, Сторер Ніколас П., Мід Томас, Шитс Джоел Дж.

МПК: A01H 5/00, A01H 5/10, A01N 63/02 ...

Мітки: білок, рослина, містить, інсектицидний, трав'яною, яка, експресує, совкою, cry1fa, трансгенна, боротьби, кодує, cry1da, днк

Формула / Реферат:

1. Трансгенна рослина, яка містить ДНК, що кодує і експресує інсектицидний білок Cry1Da, і ДНК, що кодує і експресує інсектицидний білок Cry1Fa.2. Трансгенна насінина рослини за п. 1, яка містить ДНК, що кодує і експресує інсектицидний білок Cry1Da, і ДНК, що кодує і експресує інсектицидний білок Cry1Fa.3. Трансгенна рослина за п. 1, де ДНК, що кодує і експресує інсектицидний білок Cry1Da, і ДНК, що кодує і експресує...

Спосіб виявлення дезоксирибонуклеїнової кислоти (днк) шигатоксинпродукуючих бактерій е. coli (stec)

Завантаження...

Номер патенту: 112623

Опубліковано: 26.12.2016

Автори: Дерябін Олег Миколайович, Касянчук Вікторія Вікторівна, Бергілевич Олександра Миколаївна, Сміянов Владислав Анатолійович, Єфімова Ольга Миколаївна, Кустуров Володимир Борисович

МПК: A61K 39/108, G01N 1/00

Мітки: бактерій, виявлення, дезоксирибонуклеїнової, stec, кислоти, спосіб, шигатоксинпродукуючих, днк

Формула / Реферат:

Спосіб виявлення дезоксирибонуклеїнової кислоти (ДНК) шигатоксинпродукуючих бактерій E. coli (STEC), що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) за допомогою мультиплексного варіанта полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно синтезовані олігонуклеотидні праймери з наступною послідовністю нуклеотидів:для гена токсину stx2...

Трансгенна рослина, яка містить днк, що кодує білок cry1da, і днк, що кодує білок cry1ca, для керування стійкими комахами spodoptera frugiperda

Завантаження...

Номер патенту: 112409

Опубліковано: 12.09.2016

Автори: Бертон Стефані Л., Нарва Кеннет, Шитс Джоел Дж., Вуслі Аарон Т., Сторер Ніколас П., Мід Томас

МПК: A01H 5/10, A01N 63/02, A01H 5/00 ...

Мітки: містить, яка, днк, стійкими, білок, frugiperda, кодує, керування, cry1da, трансгенна, spodoptera, рослина, комахами, cry1ca

Формула / Реферат:

1. Трансгенна рослина, яка містить ДНК, що кодує білок Cry1Da, який має інсектицидну дію, і ДНК, що кодує білок Сrу1Са, який має інсектицидну дію.2. Трансгенна рослина за п. 1, де вказана рослина додатково містить ДНК, що кодує третій білок, який має інсектицидну дію, при цьому вказаний третій білок вибирають із групи, яка складається з Cry1Fa, Vip3Ab, Cry1Be i Cry1E.3. Трансгенна рослина за п. 2, де вказаний третій білок, який...

Трансгенна рослина, що містить днк, яка кодує інсектицидний білок cry1cа та cry1аb для боротьби з лускокрилими шкідниками

Завантаження...

Номер патенту: 112287

Опубліковано: 25.08.2016

Автори: Вуслі Аарон Т., Нарва Кеннет, Мід Томас, Шитс Джоел Дж., Бертон Стефані Л., Сторер Ніколас П.

МПК: C07K 14/325, C12N 15/82, A01N 63/02 ...

Мітки: інсектицидний, рослина, боротьби, яка, білок, cry1ca, містить, шкідниками, лускокрилими, cry1ab, трансгенна, кодує, днк

Формула / Реферат:

1. Трансгенна рослина, що має стійкість до комах-шкідників кукурудзяної листової совки (FAW; Spodoptera frugiperda) і/або вогнівки цукрової тростини (SCB; Diatraea saccharalis), що містить ДНК, яка кодує інсектицидний білок Cry1Ca з послідовністю SEQ ID NO: 2, і ДНК, яка кодує інсектицидний білок Cry1Ab з послідовністю SEQ ID NO: 3; де вказану рослину вибирають з групи, що складається з кукурудзи, сої, цукрової тростини і бавовни.2....

Трансгенна рослина, яка містить днк, що кодує інсектицидний білок сry1ca, і днк, що кодує інсектицидний білок сry1fa, для вироблення резистентності до комах

Завантаження...

Номер патенту: 112156

Опубліковано: 10.08.2016

Автори: Шитс Джоел Дж., Вуслі Аарон Т., Нарва Кеннет, Сторер Ніколас П., Мід Томас, Бертон Стефані Л.

МПК: A01H 5/10, A01H 5/00, A01N 63/02 ...

Мітки: сry1fa, комах, інсектицидний, трансгенна, рослина, яка, вироблення, білок, містить, резистентності, сry1ca, кодує, днк

Формула / Реферат:

1. Трансгенна рослина, яка містить ДНК, що кодує інсектицидний білок Cry1Cа, і ДНК, що кодує інсектицидний білок Cry1Fа.2. Трансгенне насіння рослини за п. 1, яке містить ДНК, що кодує інсектицидний білок Cry1Cа, і ДНК, що кодує інсектицидний білок Cry1Fа.3. Трансгенна рослина за п. 1, де ДНК, що кодує інсектицидний білок Cry1Cа, і ДНК, що кодує інсектицидний білок Cry1Fа, були введені у вказану рослину шляхом інтрогресії....

Спосіб виділення дезоксирибонуклеїнової кислоти (днк) з парафінових гістологічних блоків

Завантаження...

Номер патенту: 108736

Опубліковано: 25.07.2016

Автори: Кузенко Євген Вікторович, Романюк Анатолій Миколайович, Линдін Микола Сергійович

МПК: C12N 15/10

Мітки: дезоксирибонуклеїнової, днк, виділення, блоків, спосіб, парафінових, кислоти, гістологічних

Формула / Реферат:

Спосіб виділення дезоксирибонуклеїнової кислоти (ДНК) з парафінових гістологічних блоків, що включає отримання на мікротомі парафінізованих зрізів тканин із парафінізованого зразка тканин, підготовку їх гістологічним методом, депарафінізацію гістологічних зрізів, розділення розчину з ДНК шляхом центрифугування з наступним його виділенням, який відрізняється тим, що депарафінізацію підготовлених гістологічних зрізів здійснюють при кімнатній...

Трансгенна рослина цукрової тростини, яка містить днк, що кодує інсектицидний білок cry1fa, і днк, що кодує інсектицидний білок cry1ab, для боротьби з вогнівкою цукрової тростини

Завантаження...

Номер патенту: 112056

Опубліковано: 25.07.2016

Автори: Бертон Стефані Л., Нарва Кеннет, Шитс Джоел Дж., Сторер Ніколас П., Мід Томас

МПК: A01N 63/02, A01H 5/00, A01H 5/10 ...

Мітки: цукрової, білок, cry1ab, днк, cry1fa, інсектицидний, тростини, вогнівкою, трансгенна, яка, боротьби, рослина, кодує, містить

Формула / Реферат:

1. Трансгенна рослина цукрової тростини, яка містить ДНК, що кодує інсектицидний білок Cry1Fa, і ДНК, що кодує інсектицидний білок Cry1Ab.2. Трансгенна рослина цукрової тростини за п. 1, в якій ДНК, що кодує коровий токсиновмісний білок Cry1Fa, і ДНК, що кодує коровий токсиновмісний білок Cry1Ab, інтрогресовані у вказану рослину цукрової тростини.3. Частина трансгенної рослини за п. 1, яка містить ДНК, що кодує інсектицидний...

Трансгенна рослина, яка містить днк, що кодує інсектицидний білок vip3ab, і днк, що кодує інсектицидний білок cry1ca, для керування резистентністю комах

Завантаження...

Номер патенту: 111936

Опубліковано: 11.07.2016

Автори: Шитс Джоел Дж., Вуслі Аарон Т., Мід Томас, Сторер Ніколас П., Бертон Стефані Л., Нарва Кеннет

МПК: A01H 5/10, A01H 5/00, A01N 63/02 ...

Мітки: білок, рослина, керування, cry1ca, кодує, днк, резистентністю, трансгенна, містить, яка, vip3ab, комах, інсектицидний

Формула / Реферат:

1. Трансгенна рослина, яка містить ДНК, що кодує білок Vip3Ab, який має інсектицидну дію, і ДНК, що кодує білок Cry1Сa, який має інсектицидну дію.2. Трансгенна рослина за п. 1, де вказана рослина додатково містить ДНК, що кодує третій білок, який має інсектицидну дію, при цьому вказаний третій білок вибирають з групи, що складається з Cry1Fa, Cry1Da, Cry1Be і Cry1E.3. Трансгенна рослина за п. 2, де вказаний третій білок...

Трансгенна рослина, яка містить днк, що кодує інсектицидний білок cry1ab, і днк, що кодує інсектицидний білок cry1be, для керування резистентністю комах

Завантаження...

Номер патенту: 111935

Опубліковано: 11.07.2016

Автори: Нарва Кеннет, Бертон Стефані Л., Шитс Джоел Дж., Вуслі Аарон Т., Сторер Ніколас П., Мід Томас

МПК: A01H 5/00, A01N 63/02, A01H 5/10 ...

Мітки: днк, комах, білок, керування, рослина, резистентністю, cry1ab, інсектицидний, містить, cry1be, трансгенна, кодує, яка

Формула / Реферат:

1. Трансгенна рослина, яка містить ДНК, що кодує інсектицидний білок Cry1Ab, і ДНК, що кодує інсектицидний білок Cry1Be.2. Трансгенна рослина за п. 1, де вказана рослина додатково містить ДНК, що кодує третій інсектицидний білок, де вказаний третій білок вибраний з групи, що складається з Cry2A, Cry1I і DIG-3.3. Трансгенна рослина за п. 2, де вказана рослина додатково містить ДНК, що кодує інсектицидний білок Cry1Fa, і ДНК, що...

Трансгенна рослина, що містить днк, яка кодує інсектицидний білок vip3ab, і днк, яка кодує інсектицидний білок cry1fa, стійка до лускокрилих шкідників

Завантаження...

Номер патенту: 111934

Опубліковано: 11.07.2016

Автори: Мід Томас, Нарва Кеннет, Шитс Джоел Дж., Бертон Стефані Л., Вуслі Аарон Т., Сторер Ніколас П.

МПК: A01N 63/02, A01H 5/10, A01H 5/00 ...

Мітки: кодує, лускокрилих, cry1fa, днк, стійка, vip3ab, шкідників, білок, містить, яка, рослина, інсектицидний, трансгенна

Формула / Реферат:

1. Трансгенна рослина, що містить ДНК, яка кодує інсектицидний білок Vip3Ab, і ДНК, яка кодує інсектицидний білок Cry1Fa, де вказаний інсектицидний білок Cry1Fa є щонайменше на 95 % ідентичним SEQ ID NO:1, і вказаний інсектицидний білок Vip3Ab є щонайменше на 95 % ідентичним SEQ ID NO:2.2. Насінина рослини за п. 1, що містить ДНК, яка кодує інсектицидний білок Vip3Ab, і ДНК, яка кодує інсектицидний білок Cry1Fa.3....

Спосіб визначення днк бактерій виду chlamydia abortus, chlamydia pecorum, chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу р (rnase p rna)

Завантаження...

Номер патенту: 110546

Опубліковано: 12.01.2016

Автори: Ксьонз Ігор Миколайович, Цівенко Тетяна Михайлівна, Почерняєв Костянтин Федорович

МПК: C12Q 1/68, C12R 1/01

Мітки: ампліфікації, виду, полімеразній, визначення, ендорибонуклеазу, psittaci, гена, спосіб, шляхом, chlamydia, rnase, фрагмента, pecorum, кодує, abortus, реакції, ланцюговий, бактерій, днк

Формула / Реферат:

Спосіб визначення ДНК бактерій виду Chlamydia abortus, Chlamydia pecorum, Chlamydia psittaci у полімеразній ланцюговій реакції шляхом ампліфікації фрагмента гена, що кодує ендорибонуклеазу Р (RNase Р RNA), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки фрагмента гена RNase Р RNA здійснюють за допомогою пари праймерів: прямого:CHCPF:5`-GGAGAAACTCCAGGGGCCGT-3` та зворотного:...

Спосіб виявлення днк yersinia enterocolitica за допомогою “напівгніздового” методу полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 103102

Опубліковано: 10.12.2015

Автори: Головко Анатолій Миколаєвич, Виговська Лілія Миколаївна, Поліщук Наталія Миколаївна, Мачуський Олександр Вікторович, Ушкалов Артем Валерійович, Дерябін Олег Миколайович

МПК: C12Q 1/00, G01N 33/00, A61K 31/00 ...

Мітки: enterocolitica, ланцюгової, виявлення, днк, методу, напівгніздового, yersinia, реакції, спосіб, допомогою, полімеразної

Формула / Реферат:

Спосіб виявлення ДНК бактерії YERSINIA ENTEROCOLITICA за допомогою полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (ДНК) збудника за допомогою "напівгніздового" варіанта полімеразної ланцюгової реакції (ПЛР) - ферментативної реакції і трьох штучно синтезованих олігонуклеотидних праймерів, які дозволяють багаторазово копіювати специфічні ділянки ДНК...

Спосіб зниження інфекційних властивостей днк- та рнк-вмісних вірусів

Завантаження...

Номер патенту: 101429

Опубліковано: 10.09.2015

Автори: Дгебуадзе Шота, Ташута Віктор Сергійович, Клестова Зінаїда Сергіївна, Вороніна Алла Костянтинівна

МПК: A61P 31/14, A61D 99/00, A61K 45/00 ...

Мітки: інфекційних, днк, рнк-вмісних, зниження, вірусів, властивостей, спосіб

Формула / Реферат:

Спосіб зниження інфекційних властивостей ДНК- та РНК-вмісних вірусів, який відрізняється тим, що застосовують як інгібітор вірусів індолвмісну конденсовану тетрациклічну сполуку 3Н-бензофуро(2,3-f)-1,2,3-бензотриазолу, при цьому процес здійснюють у культурах клітин тваринного походження ВНK-21, СНЕВ та SK-6 за використання трьох схем застосування сполуки.

Спосіб визначення днк бактерій chlamydia felis у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (момр)

Завантаження...

Номер патенту: 109489

Опубліковано: 25.08.2015

Автори: Почерняєв Костянтин Федорович, Цівенко Тетяна Михайлівна, Ксьонз Ігор Миколайович

МПК: C12R 1/01, C12Q 1/68

Мітки: днк, гена, felis, білка, полімеразній, ампліфікації, момр, ланцюговий, фрагменту, chlamydia, бактерій, головного, реакції, шляхом, визначення, мембрани, спосіб

Формула / Реферат:

Спосіб визначення ДНК збудника хламідійних інфекцій домашніх котів у полімеразній ланцюговій реакції шляхом ампліфікації фрагменту гена головного білка мембрани (МОМР), який відрізняється тим, що ампліфікацію консервативної за нуклеотидним складом ділянки ДНК МОМР бактерії Chlamydia felis здійснюють з використанням пари праймерів: прямого CHFMF 5'-GCAGCTTCTGGAACTGCAAGC-3' та зворотного CHFMR 5'-GGCGАААТСAGTTCCTGCAAGА-3' з одержанням...

Спосіб виявлення днк патогенних лептоспір роду leptospira, виду leptospira interrogans у клінічному і патологічному матеріалі та зразках води за допомогою полімеразної ланцюгової реакції у режимі реального часу

Завантаження...

Номер патенту: 101190

Опубліковано: 25.08.2015

Автори: Куликова Влада Вячеславівна, Уховський Віталій Вікторович, Кучерявенко Олександр Олександрович

МПК: C07K 14/20

Мітки: interrogans, роду, виду, часу, води, зразках, ланцюгової, патогенних, матеріали, полімеразної, лептоспір, спосіб, режимі, допомогою, реакції, патологічному, клінічному, днк, реального, leptospira, виявлення

Формула / Реферат:

Спосіб виявлення ДНК патогенних лептоспір роду Leptospira, виду Leptospira interrogans у клінічному і патологічному матеріалі та зразках води за допомогою полімеразної ланцюгової реакції у реальному часі (ПЛР-РЧ), який здійснюють за допомогою специфічних фрагментів нуклеїнових кислот (ДНК) та гібридизаційно-флуоресценції детекції продуктів ампліфікації у режимі реального часу, який відрізняється тим, що результат ампліфікації ДНК патогенних...

Спосіб виявлення днк бактерії coxiella burnetii збудника ку-лихоманки за допомогою полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 100232

Опубліковано: 10.07.2015

Автори: Головко Анатолій Миколайович, Дерябін Олег Миколайович, Неволько Олег Михайлович, Марущак Людмила Василівна

МПК: C12Q 1/68

Мітки: бактерії, coxiella, ланцюгової, burnetii, полімеразної, реакції, ку-лихоманки, допомогою, спосіб, виявлення, збудника, днк

Формула / Реферат:

Спосіб виявлення ДНК бактерії Coxiella burnetii збудника Ку-лихоманки за допомогою полімеразної ланцюгової реакції, що включає виявлення в досліджуваних зразках специфічних фрагментів нуклеїнової кислоти (НК) гену соm l, який кодує висококонсервативний білок зовнішньої мембрани з М.м 27kDа збудника Ку-лихоманки за допомогою полімеразної ланцюгової реакції (ПЛР), який відрізняється тим, що для проведення ПЛР використовують штучно...

Спосіб отримання днк для полімеразно-ланцюгової реакції із тканин пухлини

Завантаження...

Номер патенту: 99734

Опубліковано: 25.06.2015

Автори: Лісяний Олександр Миколайович, Ключникова Антоніна Іванівна, Потапова Антоніна Ігнатіївна, Лісяний Микола Іванович, Малишева Тетяна Анатоліївна

МПК: C12N 15/00

Мітки: днк, реакції, пухлини, спосіб, полімеразно-ланцюгової, отримання, тканин

Формула / Реферат:

Спосіб отримання ДНК для полімеразно-ланцюгової реакції(ПЛР) із тканин пухлини, що є молекулярно-генетичним методом досліджень, який відрізняється тим, що для спрощення зберігання досліджуваних тканин та широкого і доступного використання методів на основі ПЛР, використовують фіксовані формаліном та заключні в парафін зразки різних тканин, в т.ч. пухлин людини, шляхом отримання із них гістологічних тонких зрізів товщиною до 10 нм, далі...

Спосіб визначення успадкування стійкості картоплі до раку synchytrium endobioticum (schilb) perc. плр аналізом днк

Завантаження...

Номер патенту: 99352

Опубліковано: 25.05.2015

Автори: Карелов Анатолій Валерійович, Зеля Аврелія Георгіївна, Козуб Наталія Олександрівна, Пилипенко Лілія Амінівна, Бондарчук Анатолій Андрійович, Зеля Георгій Віорелович, Борзих Олександр Іванович, Олійник Тетяна Миколаївна, Захарчук Наталья Анатолівна, Гунчак Володимир Михайлович, Фурдига Микола Миколайович

МПК: A01C 1/00

Мітки: endobioticum, раку, стійкості, schilb, плр, спосіб, визначення, perc, днк, успадкування, synchytrium, картоплі, аналізом

Формула / Реферат:

Спосіб визначення успадкування стійкості картоплі до раку Synchytrium endobioticum (Schilb) Perc, що включає зараження паростків картоплі літніми зооспорами збудника хвороби і їх аналіз, який відрізняється тим, що з вихідних батьківських форм картоплі, а також з гібридів, отриманих від комбінацій схрещування виділяють ДНК, проводять їх електрофорез в агарозному гелі і за виявленими продуктами ампліфікації ДНК ідентифікують сприйнятливі до...

Спосіб визначення днк культури lactococcus lactis subsp. lactis за допомогою специфічних праймерів методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107897

Опубліковано: 25.02.2015

Автори: Жукова Ярослава Фрідріхівна, Король Цвітана Олександрівна, Малова Валерія Всеволодівна, Вакуленко Микола Михайлович, Науменко Оксана Василівна

МПК: C12N 15/00

Мітки: полімеразної, культури, визначення, допомогою, специфічних, lactococcus, lactis, днк, subsp, ланцюгової, реакції, праймерів, методом, спосіб

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. lactic за допомогою специфічних праймерів методом полімеразної ланцюгової реакції у заквасках, бактеріальних препаратах та ферментованих харчових продуктах, який відрізняється тим, що для визначення ДНК культури Lactococcus lactis subsp. lactis, використовують пару олігонуклеотидних праймерів до гену асmА N-ацетилмурамідази:прямий...

Спосіб визначення днк культури lactococcus lactis subsp. cremoris методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107547

Опубліковано: 12.01.2015

Автори: Малова Валерія Всеволодівна, Вакуленко Микола Михайлович, Семенівська Олена Анатоліївна

МПК: C12N 15/09

Мітки: полімеразної, ланцюгової, днк, cremoris, subsp, методом, визначення, lactococcus, спосіб, культури, lactis, реакції

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. cremoris у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції,який відрізняється тим, що для визначення ДНК культур Lactococcus lactis subsp. cremoris, застосовують пару олігонуклеотидних праймерів до гену recN DNA repair protein:прямий праймер

Спосіб визначення днк культури lactococcus lactis subsp. lactis методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 107546

Опубліковано: 12.01.2015

Автори: Семенівська Олена Анатоліївна, Вакуленко Микола Михайлович, Малова Валерія Всеволодівна

МПК: C12N 15/09

Мітки: lactis, реакції, днк, lactococcus, методом, subsp, спосіб, визначення, полімеразної, культури, ланцюгової

Формула / Реферат:

Спосіб визначення ДНК культури Lactococcus lactis subsp. lactic у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції, який відрізняється тим, що для визначення ДНК культури Lactococcus lactis subsp. lactis застосовують пару олігонуклеотидних праймерів до гену recN DNA repair protein:прямий праймер recN F: 5'- CAGGCTGAAGAAATTGAAGC-3' 20 bp тазворотній праймер recN R: 5'-...

Спосіб отримання зразків тканини плаценти для подальшої діагностики днк збудників урогенітальних інфекцій методом полімеразно-ланцюгової реакції

Завантаження...

Номер патенту: 95219

Опубліковано: 10.12.2014

Автори: Мартиненко Сергій Іванович, Шаблій Володимир Анатолійович, В'ялих Жанна Едуардівна, Вихристюк Ірина Олександрівна, Безкоровайна Лілія Володимирівна, Лобинцева Галина Степанівна, Задорожна Вікторія Іванівна, Ціленко Лариса Миколаївна, Бойко Оксана Іванівна, Покас Олена Вікторівна, Приходько Тетяна Олександрівна

МПК: A61B 10/00, G01N 33/48

Мітки: методом, тканини, спосіб, збудникiв, днк, полімеразно-ланцюгової, отримання, інфекцій, реакції, діагностики, подальшої, зразків, урогенітальних, плаценти

Формула / Реферат:

Спосіб отримання зразків тканини плаценти для подальшої діагностики ДНК збудників урогенітальних інфекцій, що включає відбір зразка для досліджень, який відрізняється тим, що знімають амніотичну оболонку з плаценти з декількох місць, по всій поверхні якої роблять зскрібок та вміщують отриманий зразок в пробірку ємністю 2 мл, що містить 0,75 мл фармакопейного стерильного 0,9 % розчину натрію хлориду.

Спосіб виявлення днк патогенних лептоспір роду leptospira, виду leptospira interrogans у клінічному і патологічному матеріалі та зразках води

Завантаження...

Номер патенту: 94104

Опубліковано: 27.10.2014

Автори: Пискун Антон Володимирович, Кучерявенко Олександр Олександрович, Куликова Влада Вячеславівна, Скалига Марина Леонідівна, Уховський Віталій Вікторович

МПК: C12N 1/00

Мітки: виду, води, матеріали, клінічному, зразках, патологічному, виявлення, патогенних, лептоспір, роду, leptospira, interrogans, спосіб, днк

Формула / Реферат:

Спосіб виявлення ДНК патогенних лептоспір роду Leptospira, виду Leptospira interrogans у клінічному і патологічному матеріалі та зразках води, який здійснюють за допомогою специфічних олігонуклеотидних праймерів Lepto, що кодують специфічні ділянки гена мембранного протеїну Lip L 32 довжиною 264 пари нуклеотидних залишків, використовуючи полімеразну ланцюгову реакцію - ПЛР, яка включає наступні стадії: екстракцію ДНК із досліджуваних...

Спосіб визначення днк культур lactococcus lactis subsp. lactic та lactococcus lactis subsp. cremoris методом полімеразної ланцюгової реакції

Завантаження...

Номер патенту: 105310

Опубліковано: 25.04.2014

Автори: Семенівська Олена Анатоліївна, Вакуленко Микола Михайлович, Малова Валерія Всеволодівна

МПК: C12N 15/09

Мітки: ланцюгової, subsp, визначення, реакції, спосіб, методом, культур, lactis, полімеразної, cremoris, lactic, днк, lactococcus

Формула / Реферат:

Спосіб визначення ДНК культур Lactococcus lactis subsp. lactic та Lactococcus lactis subsp. cremoris у бактеріальних препаратах та ферментованих харчових продуктах методом полімеразної ланцюгової реакції, які відрізняються тим, що для визначення ДНК культур Lactococcus lactis subsp. lactis та Lactococcus lactis subsp. cremoris, застосовують пари олігонуклеотидних праймерів до гену recN...