Спосіб диференційної діагностики африканської та класичної чуми свиней методом дуплексної полімеразної ланцюгової реакції у режимі реального часу

Завантажити PDF файл.

Формула / Реферат

Спосіб диференційної діагностики африканської та класичної чуми свиней (АЧС та КЧС) методом дуплексної полімеразної ланцюгової реакції у режимі реального часу, що включає ідентифікацію цільових ділянок гена B646L вірусу АЧС та 5' UTR вірусу КЧС, який відрізняється тим, що ампліфікація проводиться одночасно в одній пробірці з використанням двох пар специфічних праймерів: 1) для АЧС - ASF F (5' CTG СТС ATG GTA ТСА АТС ТТА TCG А 3') та ASF R (5' GAT АСС АСА AGA ТСА GCC GT 3'); 2) для КЧС - CSF5uf (5' TGA GTA CAG GAC AGT CGT CAG TAG TTC 3') та CSF5ur (5' TGC CCT CGT CCA CAT AGC AA 3'), а також наявністю внутрішнього контролю виділення.

Текст

Реферат: Спосіб диференційної діагностики африканської та класичної чуми свиней (АЧС та КЧС) методом дуплексної полімеразної ланцюгової реакції у режимі реального часу включає ідентифікацію цільових ділянок гена B646L вірусу АЧС та 5' UTR вірусу КЧС. При цьому ампліфікація проводиться одночасно в одній пробірці з використанням двох пар специфічних праймерів: 1) для АЧС - ASF F (5' CTG СТС ATG GTA ТСА АТС ТТА TCG А 3') та ASF R (5' GAT АСС АСА AGA ТСА GCC GT 3'); 2) для КЧС - CSF5uf (5' TGA GTA CAG GAC AGT CGT CAG TAG TTC 3') та CSF5ur (5' TGC CCT CGT CCA CAT AGC AA 3'), а також наявністю внутрішнього контролю виділення. UA 122578 U (12) UA 122578 U UA 122578 U 5 10 15 20 25 30 Корисна модель належить до галузі ветеринарної медицини і може бути використана для диференційної діагностики африканської чуми свиней (АЧС) та класичної чуми свиней (КЧС). АЧС і КЧС - два окремих транскордонних висококонтагіозних захворювання свійських і диких свиней, що завдають величезних збитків свинарству та становить загрозу експортному потенціалу всього агропромислового комплексу країни. У разі підозри на АЧС, в першу чергу необхідно диференціювати ці захворювання. Клінічні ознаки та патологоанатомічними змінами при АЧС та КЧС схожі, тож для диференційної діагностики необхідно проводити лабораторні дослідження, зокрема методом ПЛР, що характеризується високою специфічністю і чутливістю. Відомий спосіб діагностики АЧС методом одностадійної ПЛР в реальному часі, який включає відбір зразків, екстракцію ДНК із зразків, ампліфікацію та аналіз результатів [African swine fever. OIE Manual of Standards for Diagnostic Tests and Vaccines, Seventh Edition, Chapter 2.8.1. - 2012. P. 1067-1081]. Цей спосіб ґрунтується на застосуванні однієї пари праймерів до цільової висококонсервативної ділянки гену B646L, що забезпечує синтез фрагменту розміром 250 п.н. Це рішення може бути прототипом. Недоліком прототипу є відсутність внутрішнього контролю (ВК), що унеможливлює аналіз якості проведення ПЛР на етапі виділення ДНК. Також даний спосіб не дає можливості проводити диференційну діагностику АЧС та КЧС, оскільки передбачає виявлення лише ДНК вірусу АЧС, а для детекції РНК вірусу КЧС необхідно додатково проводити ПЛР з використанням іншої тест-системи. В основу корисної моделі поставлено задачу розробити чутливий та специфічний спосіб одночасного виявлення збудників АЧС і КЧС та їх диференційної діагностики методом ПЛР у режимі реального часу. Поставлена задача вирішується тим, що для виявлення ДНК вірусу АЧС та РНК вірусу КЧС використано метод дуплексної зворотно-транскриптазної полімеразної ланцюгової реакції (ЗТПЛР) у режимі реального часу. Даний спосіб передбачає проведення одночасної ампліфікації цільових ділянок гену B646L вірусу АЧС та 5' UTR вірусу КЧС в одній пробірці з використання двох пар специфічних праймерів: 1) для АЧС - ASF F і ASF R, рекомендовані МЕБ 2) для КЧС CSF5uf та CSF5ur, розроблені авторським колективом. Крім того, з метою контролю якості екстракції ДНК та виключення наявності інгібіторів у досліджуваному матеріалі розроблено праймери і до внутрішнього контрольного зразку (ВКЗ), що являє собою плазмідну ДНК з вбудованим геном PRP. В таблиці 1 представлена нуклеотидна послідовність та характеристика праймерів і флуоресцентних зондів. Таблиця 1 Перелік праймерів і флуоресцентних зондів для детекції ДНК вірусу АЧС, кДНК вірусу КЧС і внутрішнього контролю ПЛР Назва праймера ASF F ASF R ASF Probe CSF5uf CSF5ur CSF5uP PRF PRR PRP Probe 35 40 Нуклеотидна послідовність, 5'-3' CTGCTCATGGTATCAATCTTATCGA GATACCACAAGATCAGCCGT FAM-CCACGGGAGGAA TACCAACCCAGTG-RTQ1 TGAGTACAGGACAGTCGTCAGTAGTTC TGCCCTCGTCCACATAGCA ROX-ACGTGAGCAGAAGCCCACCTCGA-BHQ1 ACGTGGGCCTCTGCAAGA GACTGCCCTGTCCTGGGTATC R6G-CGACCAAAACCTGGAGGAGGATGGA-BHQ2 Призначення Ампліфікація АЧС Ампліфікація КЧС Ампліфікація ВКЗ Технологічний процес запропонованого способу складається з екстракції нуклеїнових кислот з біологічного матеріалу, ампліфікації та обліку результатів. Зворотна транскрипція, що забезпечує видозмінення РНК вірусу КЧС в молекулу комплементарної ДНК (кДНК), об'єднана з ампліфікацією. Екстракція ДНК. Для дослідження використовують клінічний матеріал (кров, плазма, сироватка), патологічний матеріал (лімфатичні вузли, селезінку, легені, тощо), вірусовмісну культуральну рідину та ін. Виділення ДНК/РНК проводять за допомогою комерційних комплектів "РИБО-сорб" та "РИБО-преп" (AmpliSens, Росія), або аналогів згідно інструкції виробника. На етапі виділення ДНК/РНК у пробірку з лізуючим розчином для кожної досліджуваної проби, які використовують в об'ємі 100 мкл, додають 10 мкл ВКЗ. 1 UA 122578 U 5 Ампліфікація. Для постановки ПЛР готують реакційну суміш, об'ємом 20 мкл з розрахунку на одну реакцію, яка включає наступні компоненти: - 17,0 мкл ПЛР-суміші; - 3,0 мкл Праймер-суміші. До приготовленої реакційної суміші додають 5 мкл виділеної ДНК/РНК з досліджуваного матеріалу. Додатково ставлять позитивний (К+) та негативний (К-) контролі реакції ампліфікації, вносячи у реакційну суміш по 5 мкл позитивного контролю (ПК АЧС+КЧС) та негативного контролю (НК) відповідно. Умови реакції ампліфікації представлені в таблиці 2. 10 Таблиця 2 Умови ампліфікації ДНК/кДНК вірусу АЧС та КЧС № з/п 1 2 2 15 20 Етапи Температура, °C Час 50 95 95 58 72 30 хв 10 хв 20 с 20 с 30 с Зворотна транскрипція Початкова денатурація ДНК Денатурація ДНК Відпалювання праймерів Елонгація Кількість циклів 1 1 45 Результат ампліфікації ДНК вірусу АЧС реєструють за барвником FAM (канал Green), кДНК вірусу КЧС - за барвником ROX (канал Orange), a результат ампліфікації ВКЗ - за барвником JOE (канал Yellow) за температури 58 °C на етапі відпалювання праймерів. Для даної методики використовують доступні системи ампліфікації у реальному часі, наприклад "Rotor-Gene Q" (QIAGEN Hilden), ABI PRISM SDS 7000 (Applied Biosystems) або подібні. Облік та інтерпретація результатів. Облік результатів ПЛР аналізу проводиться за наявності або відсутності перетину кривої флуоресценції з встановленою на відповідному рівні пороговою лінією, що відповідає наявності або відсутності значення порогового циклу Ct. Достовірність проведеного аналізу оцінюється шляхом порівняння отриманих результатів контрольних зразків ПЛР відповідно до критеріїв, що зазначені у таблиці 3. Таблиця 3 Оцінка результатів аналізу контрольних зразків ПЛР Контролі ВКЗ (В-) НКЗ (К-) ПКЗ (К+) 25 30 35 40 Етап аналізу екстракція ампліфікація ампліфікація Ct пo FAM/Green відсутнє відсутнє ≤35 Ct пo ROX/Orange відсутнє відсутнє ≤35 Ct пo JOE/Yellow ≤35 відсутнє відсутнє Досліджуваний зразок вважають позитивним щодо АЧС, якщо значення Ct пo FAM менше або дорівнює 40 (Ct≤40), що свідчить про ампліфікацію цільової ділянки гену вірусу АЧС. Зразок позитивний щодо КЧС, якщо значення Ct пo ROX менше або дорівнює 40 (Ct≤40), що свідчить про ампліфікацію цільової ділянки гену вірусу АЧС. Зразок вважається негативним, якщо значення Ct по FAM та ROX відсутнє, але значення Ct по JOE (ампліфікації ВКЗ) - менше або дорівнює 35 (Ct≤35). Приклад: Виявлення ДНК вірусу АЧС та РНК вірусу КЧС у досліджуваних зразках патологічного і біологічного матеріалу методом ЗТ-ПЛР у режимі реального часу. Виділення ДНК/РНК з досліджуваного матеріалу проводили за допомогою комерційного комплекту "РИБО-сорб" (AmpliSens, Росія) згідно інструкцій виробника. Внутрішній контроль вносили по 10 мкл у кожну пробірку. Реакційну суміш готували, змішуючи 17,0 мкл реактиву "ПЛР-суміш" та 3,0 мкл реактиву "Праймер-суміш" (у розрахунку на одну пробу). Ретельно перемішували і розносили по 20,0 мкл у чисті пробірки. Додавали по 5,0 мкл виділеної ДНК/РНК дослідних зразків та контролів. Ампліфікацію проводили за описаним вище режимом на приладі "Rotor-Gene Q" з вимірюванням флуоресценції по каналам FAM/Green, ROX/Orange та JOE/Yellow за температури 58 °C. 2 UA 122578 U Результати аналізу контрольних зразків відповідали критеріям, зазначеним у таблиці 4, що свідчить про правильність постановки даної методики та достовірність отриманих результатів. Таблиця 4 Оцінка результатів аналізу контрольних зразків методом ЗТ-ПЛР у режимі реального часу Контролі В- (ВК) К- (НК) К+ (ПК) 5 10 Ct пo FAM /Green очікуваний отриманий результат результат відсутнє відсутнє відсутнє відсутнє ≤35 13,92 Ct пo ROX/Orange очікуваний отриманий результат результат відсутнє відсутнє відсутнє відсутнє ≤35 15,29 Ct пo JOE/Yellow очікуваний отриманий результат результат ≤35 25,66 відсутнє відсутнє відсутнє відсутнє Результати ампліфікації специфічних ділянок ДНК вірусу АЧС та кДНК вірусу КЧС, а також ВКЗ у досліджуваному матеріалі представлено в таблиці 5, а криві ампліфікації – на фіг. 1-3. На фіг. 1 - криві ампліфікації ВКЗ по каналу JOE/Yellow: відповідають досліджуваному матеріалу під номерами 3-8 згідно з табл. 5; на фіг. 2 - криві ампліфікації специфічної ділянки ДНК вірусу АЧС по каналу FAM/Green: 1) К+; 4-5) пат. матеріал свині 1 та 2, що містять вірус АЧС; на фіг. 3 - криві ампліфікації специфічної ділянки РНК вірусу КЧС по каналу ROX/Orange: 1) К+; 7) кров свині, що містить вірус КЧС - референтний штам "Вашингтон". Таблиця 5 Результати ампліфікації специфічних ділянок ДНК вірусу АЧС (Ct FAM), РНК вірусу КЧС (Ct ROX) та внутрішнього контролю (Ct JOE) методом ЗТ-ПЛР у режимі реального часу №. 1 2 3 4 5 6 7 8 15 20 25 Назва досліджуваного матеріалу К+ КВ- (негативний контроль виділення) пат. матеріал свині 1, що містить вірус АЧС пат. матеріал свині 2, що містить вірусу АЧС пат. матеріал свині 3, що не містить вірусу АЧС кров свині, що містить вірус КЧС- референтний штам "Вашингтон" кров свині, що не містить вірус КЧС Ct пo FAM 13,92 17,33 27,93 Ct пo ROX 15,29 Ct пo JOE 23,68 25,06 25,66 24,52 28,76 24,58 25,08 Значення Ct по каналу JOE/Yellow реєстрували у всіх досліджуваних зразках у доступних межах (Ct≤35), що свідчить про успішне виділення ДНК/РНК. Результати ампліфікації специфічної ділянки геному вірусу АЧС реєстрували по каналу FAM/Green у двох зразках патологічного матеріалу, що завідомо містив вірус АЧС, із значенням Ct 17,33 і 27,93, що підтверджує наявність в них ДНК вірусу АЧС. Результати ампліфікації специфічної ділянки кДНК вірусу КЧС реєстували по каналу ROX/Orange в пробі крові з референтний штамом вірусу КЧС "Вашингтон", що підтверджує наявність в ній РНК вірусу КЧС. При проведенні міжнародної валідації даної методики в Інституті Ф. Леффлера (Німеччина) встановлено, що межа виявлення (LOD) діагностикума становить 10 копій ДНК АЧС та 10 копій РНК КЧС; діагностична чутливість щодо вірусу АЧС - 93,8 %, КЧС - 100 %; діагностична специфічність щодо вірусу АЧС - 100 %, КЧС - 99,4 %. Запропонована методика рекомендована для впровадження в лабораторіях ветеринарної медицини з метою диференційної діагностики АЧС і КЧС, проведення моніторингу та контролю за розповсюдженням даних інфекції. 30 ФОРМУЛА КОРИСНОЇ МОДЕЛІ 35 Спосіб диференційної діагностики африканської та класичної чуми свиней (АЧС та КЧС) методом дуплексної полімеразної ланцюгової реакції у режимі реального часу, що включає ідентифікацію цільових ділянок гена B646L вірусу АЧС та 5' UTR вірусу КЧС, який відрізняється тим, що ампліфікація проводиться одночасно в одній пробірці з використанням 3 UA 122578 U двох пар специфічних праймерів: 1) для АЧС - ASF F (5' CTG СТС ATG GTA ТСА АТС ТТА TCG А 3') та ASF R (5' GAT АСС АСА AGA ТСА GCC GT 3'); 2) для КЧС - CSF5uf (5' TGA GTA CAG GAC AGT CGT CAG TAG TTC 3') та CSF5ur (5' TGC CCT CGT CCA CAT AGC AA 3'), а також наявністю внутрішнього контролю виділення. 4 UA 122578 U Комп’ютерна верстка Г. Паяльніков Міністерство економічного розвитку і торгівлі України, вул. М. Грушевського, 12/2, м. Київ, 01008, Україна ДП “Український інститут промислової власності”, вул. Глазунова, 1, м. Київ – 42, 01601 5

Дивитися

Додаткова інформація

МПК / Мітки

МПК: G01N 33/48

Мітки: методом, класичної, часу, диференційної, реального, дуплексної, ланцюгової, чуми, свиней, полімеразної, реакції, режимі, спосіб, діагностики, африканської

Код посилання

<a href="http://uapatents.com/7-122578-sposib-diferencijjno-diagnostiki-afrikansko-ta-klasichno-chumi-svinejj-metodom-dupleksno-polimerazno-lancyugovo-reakci-u-rezhimi-realnogo-chasu.html" target="_blank" rel="follow" title="База патентів України">Спосіб диференційної діагностики африканської та класичної чуми свиней методом дуплексної полімеразної ланцюгової реакції у режимі реального часу</a>

Подібні патенти