Спосіб виявлення рнк вірусу хвороби тешена свиней методом полімеразної ланцюгової реакції в режимі реального часу

Завантажити PDF файл.

Формула / Реферат

Спосіб виявлення РНК вірусу хвороби Тешена свиней методом полімеразної ланцюгової реакції в режимі реального часу (ПЛР-РЧ), що включає виділення в досліджуваній пробі РНК вірусу, отримання кДНК, який відрізняється тим, що ампліфікація специфічної ділянки кДНК здійснюється з використанням специфічних олігонуклеотидних праймерів з наступними послідовностями: PTV-1-F - 5'TCTGTTGCTGTGAGGGTAATG, PTV-1-R - 5'AGTCTTGTGCCTGTTCTATGG, а також праймерами для внутрішнього контролю (гена PRP): PRP-F - 5'ACGTGAACCTATTCAAGA, PRP-R - 5'GACTGCAATGTCCTCCGTATC, з обліком результатів гібридизаційно-флуоресцентної детекції за допомогою автоматизованих ПЛР-ампліфікаторів.

Текст

Реферат: Спосіб виявлення РНК вірусу хвороби Тешена свиней методом полімеразної ланцюгової реакції в режимі реального часу (ПЛР-РЧ) включає виділення в досліджуваній пробі РНК вірусу, отримання кДНК. Крім цього, ампліфікація специфічної ділянки кДНК здійснюється з використанням специфічних олігонуклеотидних праймерів з наступними послідовностями: PTV1-F - 5'TCTGTTGCTGTGAGGGTAATG, PTV-1-R - 5'AGTCTTGTGCCTGTTCTATGG, а також праймерами для внутрішнього контролю (гена PRP): PRP-F - 5'ACGTGAACCTATTCAAGA, PRPR - 5'GACTGCAATGTCCTCCGTATC, з обліком результатів гібридизаційно-флуоресцентної детекції за допомогою автоматизованих ПЛР-ампліфікаторів. UA 114872 U (12) UA 114872 U UA 114872 U 5 10 15 20 25 30 Корисна модель належить до галузі ветеринарної медицини, біотехнології, молекулярної біології та діагностики. Найближчим аналогом корисної моделі є спосіб виявлення РНК вірусу хвороби Тешена методом зворотно-транскриптазної полімеразної ланцюгової реакції (ЗТ-ПЛР), що включає виділення РНК з досліджуваних проб, ампліфікування специфічної ділянки кДНК інфекційного агента та облік результатів в агарозному гелі з електрофоретичною детекцією [1]. Недоліком ЗТ-ПЛР є відсутність внутрішнього контролю ампліфікації та високий ступінь можливої контамінації приміщень і співробітників лабораторій продуктами апліфікації при обліку результатів з електрофорезом, а також візуальне оцінювання результату, що може призводити до суб'єктивної думки при інтерпретації отриманих результатів. В основу корисної моделі поставлено задачу розробити спосіб виявлення, який би усував перераховані недоліки прототипу і мав би нові якісні показники, а саме: точна візуалізація результатів реакції за допомогою позитивного та негативного контролів, а також наявність внутрішнього контролю виділення РНК; зниження витрат реагентів для реакції, скорочення часу для постановки реакції, відсутність суб'єктивності в реєстрації та інтерпретації результатів за допомогою приладів, зменшення вірогідності контамінації продуктами ампліфікації. Принциповою відмінністю методу ПЛР в режимі реального часу, порівняно з класичною ПЛР, є можливість спостереження за реакцією в реальному часі, безпосередньо вимірюючи накопичення продукту ПЛР в кожному циклі, при необхідності кількісного визначення геномеквівалентів (ГЕ) збудника в досліджуваному матеріалі, відсутність стадії електрофорезу, можливість точної реєстрації результатів реакції за допомогою приладів [2]. В основу методики покладено виділення в досліджуваній пробі РНК вірусу хвороби Тешена свиней, отримання кДНК, ампліфікація специфічної ділянки кДНК за використання специфічних олігонуклеотидних праймерів та ферменту Taq-полімерази з автоматизованим обліком результатів гібридизаційно-флуоресцентної детекції продуктів ампліфікації за допомогою ПЛРампліфікаторів. Специфічні олігонуклеотидні праймери розроблені авторським колективом на основі аналізу сиквенсів українських ізолятів і кодують білок VP1 тешовірусів 1 серотипу. При цьому зонд для детекції ампліфікації кДНК вірусів хвороби Тешена в реальному часі мічений флуоресцентним барвником FAM на 5' кінці олігонуклеотиду та гасником флуоресценції BHQ1 на 3' кінці, а для детекції внутрішнього контролю (ген PRP) - мічений флуоресцентним барвником JOE. В таблиці 1 представлена нуклеотидна послідовність та характеристика праймерів. Таблиця 1 Характеристика олігонуклетидних праймерів для детекції кДНК вірусу хвороби Тешена свиней і внутрішнього контролю ПЛР Назва праймера PTV-1-F PTV-1-R PTV-1P PRP-F PRP-R PRP-P 35 40 45 Нуклеотидна послідовність, 5'-3' TCTGTTGCTGTGAGGGTAATG AGTCTTGTGCCTGTTCTATGG FAM-ATTGTTAAGCCATCCAAACACTCTGTGC-BHQ1 ACGTGAACCTATTCAAGA GACTGCAATGTCCTCCGTATC JOE-ACCAATTCCTGGAGGAACCGA-BHQ1 Призначення Ампліфікація PTV-1 Ампліфікація ВКЗ Технологічний процес постановки ПЛР складається з екстракції нуклеїнових кислот з біологічного матеріалу, ампліфікації та обліку результатів. Так як вірус хвороби Тешена РНКвмісний, то після етапу виділення РНК з матеріалу застосовується ще один етап - зворотна транскрипція, яка забезпечує видозмінення РНК в молекулу комплементарної ДНК (кДНК). Для виділення РНК використовують комерційні комплекти "РИБО-преп" та "РИБО-сорб", або аналоги. Для проведення зворотної транскрипції - комерційний комплект "РЕВЕРТА-L" (AmpliSens, Росія) згідно з інструкцією виробника. На етапі виділення РНК у пробірку з лізуючим розчином для кожної досліджуваної проби та внутрішнього контролю виділення (В-), які використовують в об'ємі 100 мкл, додають 10 мкл ВКЗ - внутрішнього контрольного зразку, який контролює якість виділеної РНК і попереджає отримання псевдонегативних результатів. ВКЗ містить ген PRP, що кодує пріон-протеїн консервативний білок, характерний більшості видів ссавців. Отримують ген PRP клонуванням специфічної послідовності в плазмідний вектор, і використовують як внутрішній контроль 1 UA 114872 U 5 10 виділення ДНК/РНК, а також для попередження помилково-негативних результатів за рахунок пригнічення ензиматичної ампліфікації продуктами реакції і інгібіторами досліджуваної матриці. Для постановки ПЛР використовують реакційну суміш, яка включає наступні компоненти: 1 - Мастер-мікс (10 mМ Tris-HCl, 50 mМ KСl, рН 8,3), 0,25 мМ кожного дНТФ/дУТФ, 2,5 мМ MgCl2, по 10 пМ кожного з праймерів (PTV-1-F, PTV-1-R, PRP-F, PRP-R), по 5 пМ зондів (PTV1P, PRP-P); 2 - Ензим-мікс (0,5 одиниці Taq-ДНК полімерази; 0,1 одиниця урацил-ДНК-глікозилази (УДГ)). УДГ використовується для елімінації контамінації ПЛР-реакції продуктами попередньої ампліфікації. Реакційна суміш для ПЛР становить 20 мкл на одну пробу і містить 19,75 мкл Мастер-міксу та 0,25 мкл Ензим-міксу, до якої додають 5 мкл кДНК досліджувного матеріалу. Крім того, при постановці ПЛР у режимі реального часу використані контрольні зразки в об'ємі 5 мкл: ПКЗ - позитивний контрольний зразок; НКЗ - негативний контрольний зразок. Умови реакції ампліфікації представлені в таблиці 2. 15 Таблиця 2 Умови ампліфікації кДНК вірусу хвороби Тешена свиней №з/п 1 2 3 20 25 30 35 Етапи Активація УДГ Початкова денатурація кДНК Денатурація кДНК Відпалювання праймерів Елонгація кДНК Температура, °C 50 95 95 56 72 Час 5 хв 5 хв 20 с 20 с 20 с Кількість циклів 1 1 45 Результат ампліфікації РНК вірусу хвороби Тешена свиней реєструють за барвником FAM (канал Green), а результат ампліфікації внутрішнього контрольного зразка (ВКЗ) - за барвником JOE (канал Yellow) при 56 °C на етапі відпалювання праймерів. При проведенні лабораторної діагностики ензоотичного енцефаломієліту (хвороби Тешена) свиней методом полімеразної ланцюгової реакції в режимі реального часу для виявлення РНК вірусу в біологічному або патологічному матеріалі від домашніх та диких свиней використовують проби фекалій, ректальні змиви, головний та спинний мозок, кишечник, лімфатичні вузли, мигдалики, в лабораторних умовах - вірусвмісну культуральну рідину. Для даної методики використовують доступні системи ампліфікації у реальному часі, наприклад "Rotor-Gene Q" (QIAGEN Hilden), ABI PRISM SDS 7000 (Applied Biosystems), iQ5 (BIORAD) або подібні. Облік та інтерпретація результатів. Облік результатів ПЛР аналізу проводиться за наявності або відсутності перетину кривої флуоресценції з встановленою на відповідному рівні пороговою лінією, що відповідає наявності або відсутності значення порогового циклу Ct. Результати аналізу вважаються достовірними, якщо значення Ct FAM позитивного контрольного зразка (ПКЗ) менше або дорівнює 30 (Ct30) і відсутнє значення Ct негативного контрольного зразка (НКЗ), також значення Ct JOE внутрішнього контрольного зразка (ВКЗ) менше або дорівнює 35 (Ct35). Оцінка отриманих результатів показників первинного обліку контролів ПЛР повинна відповідати критеріям, що зазначені у таблиці 3. Таблиця 3 Оцінка результатів аналізу контрольних точок ПЛР Контролі К- (ΗΚ3) К+ (ПКЗ) В- (ВКЗ) Етап аналізу ампліфікація ампліфікація виділення РНК Значення Ct FAM/Green очікуваний результат відсутнє 30 відсутнє Значення Ct JOE/Yellow очікуваний результат відсутнє відсутнє 35 Досліджувані зразки позитивні, якщо значення Ct FAM менше або дорівнює 35 (Ct35), це свідчить про ампліфікацію гена, що кодує специфічну ділянку вірусу ензоотичного 2 UA 114872 U 5 10 15 20 25 енцефаломієліту (хвороби Тешена) свиней. Зразок вважається негативним, якщо значення Ct FAM відсутнє, але значення Ct JOE менше або дорівнює 35 (Ct35). Результати аналізу не враховуються при: - відсутності ампліфікації у ПКЗ по FAM; - присутності ампліфікації в НКЗ пo FAM; - якщо значення Ct досліджуваних зразків по FAM більше 35 (Ct>35); - великої розбіжності результатів у повторах. У цих випадках проводиться повторне випробування! Для прикладу надається опис методики виявлення РНК вірусу ензоотичного енцефаломієліту (хвороби Тешена) свиней методом ПЛР у режимі реального часу. Для цього використовували наступний біологічний матеріал: 1) культура клітин СНЕВ, що не містить вірус хвороби Тешена; 2) вірус хвороби Тешена, діагностичний штам "Березнянський-652"; 3) проба спинного мозку поросяти при нервово-паралітичній стадії хвороби Тешена; 4) проба головного мозку поросяти при нервово-паралітичній стадії хвороби Тешена; 5) проба головного мозку від здорового поросяти, що не містить вірус хвороби Тешена; 6) ректальний змив від здорового поросяти, що не містить вірус хвороби Тешена; 7) вірус хвороби Ауєскі - штам "Петриківський-2006"; 8) цирковірус свиней 2 типу - штам "Stoon 1010"; 9) вірус репродуктивно-респіраторного синдрому свиней (РРСС) Європейського генотипу штам "Lelystad". Для виділення РНК використовували 100 мкл досліджуваних проб і комерційний комплект "РИБО-сорб", а для проведення зворотної транскрипції - комерційний комплект "РЕВЕРТА-L" (AmpliSens, Росія) згідно інструкцій виробника. Ампліфікацію проводили за описаними вище режимами на приладі "Rotor-Gene Q" з обліком флуоресценції по FAM та JOE при 56 °C. Насамперед проводили оцінку отриманих результатів показників первинного обліку контролів ПЛР, які відповідали критеріям, що зазначені у таблиці 4. Таблиця 4 Оцінка результатів аналізу контрольних точок ПЛР Контролі К- (НКЗ) К+ (ПКЗ) В- (ВКЗ) Етап аналізу ампліфікація ампліфікація виділення РНК Значення Сt FAM/Green очікуваний отриманий результат результат відсутнє відсутнє 13,29 30 відсутнє відсутнє Значення Ct JOE/Yellow очікуваний отриманий результат результат відсутнє відсутнє відсутнє відсутнє 24,77 35 30 Отримані результати досліджуваних контролів відповідали очікуваним значенням, що свідчить про правильність постановки даної методики. Потім проводили аналіз етапу виділення РНК у досліджуваному матеріалі за барвником JOE (канал Yellow). Отримані значення Ct представлені в таблиці 5. 35 Таблиця 5 Аналіз результатів ампліфікації ВКЗ (Ct JOE) №з/п 1 2 3 4 5 6 7 8 9 Назва К+ КВ1 - культура клітин СНЕВ 2 - "Березнянський-652" 3 - спин. моз. нерв-парал. ст. 4 - гол. моз. нерв-парал. ст. 5 - гол. мозок здор. поросяти 6 - рект. змив здор. поросяти Тип позитивний контроль негативний контроль внутрішній контроль зразок зразок зразок зразок зразок зразок 3 Ct 24,77 26,07 29,80 28,41 27,60 22,81 22,88 UA 114872 U Таблиця 5 Аналіз результатів ампліфікації ВКЗ (Ct JOE) №з/п 10 11 12 5 Назва 7 - вірус хвороби Ауєскі 8 - цирковірус свиней 2 типу 9 - вірус РРСС Європ. типу Тип Ct 26,10 24,65 24,16 зразок зразок зразок Отримані значення Ct JOE у всіх пробах в допустимих межах (Ct35), що свідчить про успішне виділення РНК в досліджуваних зразках. Аналіз етапу ампліфікації специфічної ділянки кДНК вірусу хвороби Тешена свиней у досліджуваному матеріалі за барвником FAM (канал Green) представлено в таблиці 6, а криві ампліфікації представлені на кресленні. Таблиця 6 Аналіз результатів ампліфікації специфічної ділянки кДНК вірусу хвороби Тешена (Ct FAM) №з/п 1 2 3 4 5 6 7 8 9 10 11 12 10 15 20 25 30 Назва К+ КВ1 - культура клітин СНЕВ 2 - "Березнянський-652" 3 - спин. моз. нерв-парал. ст. 4 - гол. моз. нерв-парал. ст. 5 - гол. мозок здор. поросяти 6 - рект. змив здор. поросяти 7 - вірус хвороби Ауєскі 8 - цирковірус свиней 2 типу 9 - вірус РРСС Європ. типу Тип позитивний контроль негативний контроль внутрішній контроль зразок зразок зразок зразок зразок зразок зразок зразок зразок Ct 13,29 13,01 17,25 17,84 Результат ампліфікації специфічної ділянки кДНК вірусу хвороби Тешена свиней реєстрували за барвником FAM (канал Green) в пробах з діагностичним штамом "Березнянський-652" та пробах спинного та головного мозку поросяти з нервово-паралітичними симптомами, де отримані відповідно значення Ct 13,01; 17,25; 17,84, що підтверджує наявність в них РНК вірусу хвороби Тешена. При проведенні валідації даної методики згідно з вимогами ΟΙΕ [3] встановлено, що межа 4 3 виявлення (LOD) становить 1,4×10 ГЕ/см , ефективність ампліфікації не менше 94 %. Отримана висока збіжність результатів, а специфічність та достовірність методики склала близько 100 % для досліджуваних зразків. За результатами проведених досліджень встановлена відсутність хибних результатів і неспецифічних реакцій зі штамами гетерологічних вірусів. Отже, розроблений та валідований спосіб виявлення РНК вірусу хвороби Тешена свиней методом ПЛР у режимі реального часу відповідає міжнародним вимогам і гарантує отримання точних та достовірних результатів. Запропонована методика рекомендована для впровадження в лабораторіях ветеринарної медицини з метою діагностики хвороби Тешена, проведення моніторингу та контролю за розповсюдженням даної інфекції. Джерела інформації: 1. Патент на корисну модель №51560 "Спосіб виявлення РНК тешовірусів методом зворотно-транскриптазної полімеразної ланцюгової реакції" / С.В. Дерев'янко, A.M. Головко, В.В. Кацимон, Т.О. Бова, В.І. Сорока; заявник і патентовласник Інститут сільськогосподарської мікробіології Української академії аграрних наук / заявл. 28.12.09, опубл. 26.07.2010, Бюл. № 14. 2. ПЦР "в реальном времени" / Ребриков Д.В., Саматов Г.А., Трофимов Д.Ю. и др.; под ред. д.б.н. Д.В. Ребрикова; 2-е издание, испр. и доп. - М.: БИОНОРМ. Лаборатория знаний, - 2009. 223 с. 3. ΟΙΕ Validation Guidelines-3.6.3 "Development and optimisation of Nucleadacid detection assays". - 2014. - P. 11. 35 4 UA 114872 U ФОРМУЛА КОРИСНОЇ МОДЕЛІ 5 10 Спосіб виявлення РНК вірусу хвороби Тешена свиней методом полімеразної ланцюгової реакції в режимі реального часу (ПЛР-РЧ), що включає виділення в досліджуваній пробі РНК вірусу, отримання кДНК, який відрізняється тим, що ампліфікація специфічної ділянки кДНК здійснюється з використанням специфічних олігонуклеотидних праймерів з наступними послідовностями: PTV-1-F 5'TCTGTTGCTGTGAGGGTAATG, PTV-1-R 5'AGTCTTGTGCCTGTTCTATGG, а також праймерами для внутрішнього контролю (гена PRP): PRP-F - 5'ACGTGAACCTATTCAAGA, PRP-R - 5'GACTGCAATGTCCTCCGTATC, з обліком результатів гібридизаційно-флуоресцентної детекції за допомогою автоматизованих ПЛРампліфікаторів. Комп’ютерна верстка О. Рябко Державна служба інтелектуальної власності України, вул. Василя Липківського, 45, м. Київ, МСП, 03680, Україна ДП “Український інститут інтелектуальної власності”, вул. Глазунова, 1, м. Київ – 42, 01601 5

Дивитися

Додаткова інформація

МПК / Мітки

МПК: G01N 33/569

Мітки: тешена, методом, хвороби, реального, свиней, виявлення, режимі, рнк, реакції, часу, вірусу, полімеразної, ланцюгової, спосіб

Код посилання

<a href="http://uapatents.com/7-114872-sposib-viyavlennya-rnk-virusu-khvorobi-teshena-svinejj-metodom-polimerazno-lancyugovo-reakci-v-rezhimi-realnogo-chasu.html" target="_blank" rel="follow" title="База патентів України">Спосіб виявлення рнк вірусу хвороби тешена свиней методом полімеразної ланцюгової реакції в режимі реального часу</a>

Подібні патенти