Завантажити PDF файл.

Формула / Реферат

Спосіб підвищення продукції антибіотиків моеноміцинового ряду, який базується на надекспресії генів плейотропних регуляторів у актиноміцетах-продуцентах цих антибіотиків, який відрізняється тим, що як регуляторний елемент використовують ген плейотропного регулятора транскрипції adpAgh S. ghanaensis, клонований у складі інтегративної плазміди pTESaadpA-exp у штамах S. ghanaensis АТСС14672, S. lividans TK24, S. coelicolor M1152, S. albus J1074.

Текст

Реферат: Спосіб підвищення продукції антибіотиків моеноміцинового ряду, який базується на надекспресії генів плейотропних регуляторів у актиноміцетах-продуцентах цих антибіотиків, крім того як регуляторний елемент використовують ген плейотропного регулятора транскрипції adpAgh S. ghanaensis, клонований у складі інтегративної плазміди pTESaadpA-exp у штамах S. ghanaensis АТСС14672, S. lividans TK24, S. coelicolor M1152, S. albus J1074. UA 79968 U (12) UA 79968 U UA 79968 U 5 10 15 20 25 30 35 40 45 50 55 Корисна модель стосується генетики бактерій та біотехнології і може бути використана для створення штамів актиноміцетів-надпродуцентів антибіотиків моеноміцинового ряду та їхніх похідних. Відомий спосіб отримання надпродуцентів моеноміцинів, за яким опромінюють ультрафіолетом чи обробляють хімічним мутагеном спорову суспензію одного із продуцентів цієї родини сполук, Streptomyces ghanaensis. Розсівають її на поживному агаризованому середовищі та відбирають клони із підвищеним рівнем біосинтезу антибіотика [SubramaniamNiehaus В., Schneider Т., Metzger J.W., Wohlleben W. Isolation and analysis of moenomycin and its intermediates from Streptomyces ghanaensis (ATCC14672) wildtype and selected mutants // Z. Naturforsch. - 1997. - vol. 52. - P. 217-226; Schuricht U., Hennig L., Findeisen M., Endler K., Welzel P., Arigoni D. The biosynthesis of moenocinol, the lipid part of the moenomycin antibiotics // Tetrahedron Lett. - 2001. - vol. 42. - P. 3835-3837]. Однак, цей спосіб передбачає використання складних мікробіологічних процедур, є тривалим і трудомістким. Крім того, набір корисних мутацій є унікальним для кожного отриманого штаму і їх неможливо точно відтворити в іншому штамі, що продукує структурно відмінний антибіотик моеноміцинового ряду. Найближчим за технічною сутністю - прототипом є спосіб підвищення продукції + моеноміцинів штамами S. ghanaensis ATCC14672, S. lividans TK24moeno38-5 та S. albus + J1074moeno38-5 за допомогою надекспресії у їхніх клітинах гена bldA, який кодує UАА плейотропний регулятор біосинтезу антибіотиків - лейцил-тРНК . Ця тРНК декодує найрідкісніший кодон у геномах стрепоміцетів - ТТА, який присутній у кількох ключових генах біосинтезу моеноміцинів. [Патент 63820 Україна, МПК (2011) C12Q1/00, 02, 04. Спосіб підвищення продукції фосфогліколіпідних антибіотиків / Осташ Б.О., Федоренко В.О., Громико О.М., Уокер-Кане С.; заявник і власник Львівський національний університет імені Івана Франка. - № u201102624; заявл. 09.03.2011; опубл. 25.10.2011, Бюл. № 20.]. Реплікативну плазміду pIJ584, що містить ген bldA S. coelicolor, переносять з клітин Escherichia coli ЕТ12567 (pUZ8002, + pIJ584) у клітини S. ghanaensis АТСС14672, S. lividans TK24moeno38-5 та S. albus + J1074moeno38-5 за допомогою кон'югації. Транскон'юганти вирощують у 30 мл рідкого середовища TSB протягом 5 діб при 30 °C. Моеноміцини екстрагують метанолом, екстракти випаровують і сухий залишок розчиняють у 100 мкл води. Кількість моеноміцинів у зразках визначають способом дифузії антибіотика в агар або високоефективної хроматографії, спряженої із мас-спектрометрією (ВЕРХ-МС). Транскон'юганти продукують у 2-3 рази більше моеноміцинів, ніж контрольний штам. Проте, у цьому способі використовують реплікативну плазміду, що обмежує стабільність успадкування ознаки підвищеного антибіотикоутворення. Ген bldA контролює синтез моеноміцинів на рівні трансляції, що не є головним етапом регуляції продукції цієї родини сполук. Тому використання цього регулятора не дає змоги безпосередньо впливати на транскрипцію генів біосинтезу фосфогліколіпідних антибіотиків (мое-генів). В основу корисної моделі покладено задачу удосконалити спосіб підвищення продукції антибіотиків моеноміцинового ряду шляхом конститутивної надекспресії гена adpAgh, що кодує плейотропний регулятор транскрипції S. ghanaensis, на основі інтегративної плазміди, що дасть змогу стабільно успадковувати додаткову копію гена adpAgh, та підвищити продукцію антибіотика. Поставлене завдання вирішується так, що у способі підвищення продукції антибіотиків моеноміцинового ряду, який базується на надекспресії регуляторних елементів, де як регуляторний елемент використовують ген плейотропного регулятора транскрипції (adpAgh) S. ghanaensis ATCC14672, клонований у складі інтегративної плазміди pTESaadpA-exp у штамах S. ghanaensis ATCC14672, S. lividans TK24, S. albus J1074, S. coelicolor M1152. Моеноміцин А - фосфогліколіпідний антибіотик, що на декілька порядків більш активний, ніж антибіотики, що сьогодні застосовують у медицині. Він складається з 3-фосфогліцератної кислоти, що зв'язує між собою ізопреноїдний ланцюг з пентасахаридним залишком. Мінімальна інгібуюча концентрація МмА проти різних грампозитивних мікроорганізмів варіює від 1 до 100 нг/мл [Ostash В., Walker S. Moenomycin family antibiotics: chemical synthesis, biosynthesis, biological activity // Nat Prod Rep. - 2010. - vol. 27. - P. 1594-1617]. Моеноміцини належать до групи антибіотиків, мішенню дії яких є клітинна стінка бактерій, і безпосередньо діють на ферменти її синтезу - пептидогліканові глікозилтрансферази (трансглікозилази). Цей механізм дії є унікальним серед усіх досліджених на сьогодні [Ostash В., Walker S. Bacterial transglycosylase inhibitors // Curr. Opin. Chem. Biol. - 2005. - Vol. 9. - P. 459-456]. Природні штамипродуценти фосфогліколіпідів накопичують надзвичайно малі кількості антибіотика, що 1 UA 79968 U 5 10 15 20 25 30 35 40 45 50 55 60 ускладнює його практичне використання та дослідження з метою отримання клінічно цінних похідних. Авторами вперше запропоновано використати ген adpAgh S. ghanaensis у складі плазміди pTESaadpA-exp, сконструйованої на основі інтегративного вектора pTES [Herrmann S., Siegl Т., Luzhetska M., Petzke L., Jilg C., Welle E., Erb A., Leadlay P., Luzhetskyy A. Site-specific recombination strategies for engineering actinomycete genomes // Appl. Environ. Microbiol. - 2012. Vol. 78, № 6. - P. 1804-1812] для підвищення біосинтезу фосфогліколіпідних антибіотиків моеноміцинового ряду. Запропонований підхід дасть змогу значно підвищити продукцію цієї групи вторинних метаболітів, оскільки білок AdpAgh є безпосереднім активатором транскрипції UUА мoe-генів. Також AdpAgh активує транскрипцію гена лейцил-тРНК bldAgh, продукт якого декодує триплет ТТА. Наявність рідкісного кодону ТТА у кількох ключових мoe-генах є одним з факторів, що обмежує їхню експресію, а отже і продукцію фосфогліколіпідів [Ostash В., Saghatelian A., Walker S. A streamlined metabolic pathway for the biosynthesis of moenomycin A // Chem. Biol. - 2007. - vol. 14. - P. 257-267]. Надекспресія гена adpAgh забезпечить зростання пулу плейотропного регулятора AdpAgh у клітинах стрептоміцетів, внаслідок чого зросте рівень транскрипції генів, безпосередньо задіяних у біосинтезі антибіотика, що дасть змогу подолати це обмеження. Оскільки ортологи генів adpA є висококонсервативними серед актиноміцетів, їх можна вільно комбінувати між різними видами без втрати функціональної активності. Авторами також вперше запропоновано використати інтегративну плазміду для надекспресії плейотропного регулятора під контролем сильного конститутивного промотора гена стійкості до еритроміцину еrmЕ, що суттєво збільшує рівень експресії корисного гена і його позитивний вплив на продукцію антибіотика. Фіг. 1 Хімічна будова моеноміцину А - основного представника фосфогліколіпідної родини. Фіг. 2 Схема плазміди pTESaadpA-exp, де: aacA(3)lV - ген стійкості до апраміцину, оrіТ - ділянка кон'югаційного переносу плазміди RK2, int - ген інтегрази актинофага С31, lохР - ділянка впізнавання сайт-специфічної рекомбінази Сrе, attP - сайт інтеграції фага С31, adpA - ген adpAgh, клонований з хромосоми S. ghanaensis ATCC14672. Спосіб можна проілюструвати прикладами: Приклад із використанням штаму S. ghanaensis ATCC14672. Три інші штами актиноміцетів, S. lividans, S. coelicolor та S. albus, використовуються і досліджуються аналогічно. Для конструювання плазміди pTESaadpA-exp для надекспресії гена adpAgh застосовують полімеразну ланцюгову реакцію та за допомогою неї ампліфікують з хромосомної ДНК S. ghanaensis АТСС14672 фрагмент ДНК, розміром 1,4 т.п.н., що містить досліджуваний ген. Усі маніпуляції виконують згідно стандартних методик [Sambrook J., Russell D. W. Molecular cloning, a laboratory manual. 3rd ed. // Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. - 2001. - 450 P.] Для цього використовують пару праймерів adpA_exp_for (AAAGATATCACAACCGAGGAGCCGCGACCA) та adpA_exp_rev (AAAGAATTCGCCTCCGGCCCCGTCCGGTGT), що містять штучно введені сайти впізнавання для ендонуклеаз рестрикції EcoRV та EcoRI, відповідно. Амплікон елююють з агарозного гелю відповідно до стандартних методик [Sambrook J., Russell D. W. Molecular cloning, a laboratory manual. 3rd ed. // Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. - 2001. - 450 P.]. Далі отриманий фрагмент ДНК та вектор pTES [Herrmann S., Siegl Т., Luzhetska M., Petzke L., Jilg C, Welle E., Erb A., Leadlay P., Luzhetskyy A. Site-specific recombination strategies for engineering actinomycete genomes // Appl. Environ. Microbiol. - 2012. - Vol. 78, № 6. - P. 1804-1812] обробляють ендонуклеазами рестрикції EcoRV та EcoRI. Отримані лінійні фрагменти вектора та досліджуваного гена лігують між собою, далі отриманою сумішшю трансформують компетентні клітини Е. соlі і проводять селекцію трансформантів за стійкістю до апраміцину у концентрації 25 мкг/мл згідно з стандартними методиками [Sambrook J., Russell D. W. Molecular cloning, a laboratory manual. 3rd ed. // Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. - 2001. - 450 P.]. У новоствореній плазміді pTESaadpA-exp транскрипція гена adpAgh перебуває під контролем еrmЕр, як зображено на фіг. 2. Плазмідою pTESaadpA-exp трансформують штам Е. соlі ЕТ12567 (pUB307), який за рахунок tra-генів плазміди pUB307 забезпечує кон'югативне перенесення корезидентних плазмід [Flett F., Mersinias V., Smith C.P. High efficiency intergeneric conjugal transfer of plasmid DNA from Escherichia coli to methyl-DNA-restricting Streptomycetes // FEMS Microbiol. Lett - 1997. - vol. 155. P. 223-229]. Одну колонію нічної культури Escherichia coli засівають у 5 мл середовища LB з 50 2 UA 79968 U 5 10 15 20 25 30 35 40 45 50 мкг/мл канаміцину. Культуру вирощують до оптичної густини OD 6oo=0,1, переносять у мікропробірки з об'ємом 1,5 мл і осаджують центрифугуванням при 10 тис. об./хв протягом 1 хв. Зливають супернантант та клітини ресуспендують у 50 мкл середовища LB. Отриману суспензію клітин охолоджують у льоді 5 хв, додають 1 мл 0,1 М розчину СаСl 2 та інкубують у льоді 1 год. Клітини осаджують центрифугуванням при 10 тис. об./хв протягом 1 хв, зливають надосадову рідину та ресуспендують у 100 мкл 0,1 М розчину СаСl 2. Інкубують 1 год. у льоді та додають розчин плазмідної ДНК. Інкубують 1 год. у льоді, після чого клітини піддають тепловому шоку протягом 1 хв при 40 °С, охолоджують та додають 1 мл середовища LB. Інкубують 2 год. при 37 °C для індукції експресії генів стійкості та висівають на чашки з середовищем LA з 25 мкг/мл апраміцину та 50 мкг/мл канаміцину. Чашки інкубують 16 год. при 37 °C, після чого трансформанти пересівають на свіже середовище LA з 25 мкг/мл апраміцину та 50 мкг/мл канаміцину. Плазміду pTESaadpA-exp в S. ghanaensis ATCC14672 переносять шляхом міжродової кон'югації з відповідним штамом Е. coli ET12567 (pUB307). Суспензію спор штаму S. ghanaensis ATCC14672 висівають на вівсяне середовище (г/л: вівсяне борошно - 30, агар - 18, вода водопровідна - до 1 л, рН до стерилізації - 7,0; після стерилізації додають розчин хлориду магнію до кінцевої концентрації 40 мМ) та вирощують 7 діб при 37 °C для отримання спорової суспензії для кон'югаційних схрещувань. Штам Е. coli ET12567 (pUB307) з плазмідою pTESaadpA-exp висівають на чашку з середовищем LA з 25 мкг/мл апраміцину та 50 мкг/мл канаміцину та вирощують 18 год. при 37 °C. Готують суспензію клітин у 4 мл середовища LB. Одночасно готують суспензію спор штаму S. ghanaensis ATCC14672 у 7 мл стерильного фізіологічного розчину та проводять тепловий шок при 50 °C протягом 10 хв. Суспензію клітин та спор стрептоміцетів осаджують центрифугуванням 2 хв при 10000 об./хв, зливають надосадову рідину, розчиняють у 100 мкл середовища LB, змішують між собою та висівають на чашки з вівсяним середовищем. Чашки інкубують 12-16 год. при 28 °C та заливають 1 мл водного розчину 25 мкг апраміцину та 50 мкг налідиксової кислоти. Перевіряють рівень продукції фосфогліколіпідних антибіотиків транскон'югантом S. + ghanaensis pTESaadpA-exp . Штам висівають у 30 мл середовища TSB та вирощують протягом 5 діб при 37 °C. Біомасу осаджують за допомогою центрифугування, промивають водою та екстрагують 7 мл метанолу протягом 14 год. Одночасно, на чашку із середовищем LA висівають репортерний штам Bacillus cereus ATCC19637 для отримання нічної культури. Екстракт випаровують і сухий залишок розчиняють у 100 мкл води. Одночасно на чашку із середовищем LA висівають суспензію клітин нічної культури В. cereus. На паперові диски Whatman діаметром 5 мм наносять 20 мкл водного розчину і потім накладають на щойно засіяний газон репортерного штаму. Чашки з дисками інкубують при 37 °C протягом 24 год. Кількість моеноміцинів у зразках визначають вимірюванням діаметру зон пригнічення екстрактом росту В. cereus та порівнянням із діаметрами пригнічення росту з використанням дисків із відомою кількістю моеноміцину А. Транскон'юганти продукують у 2,5 рази більше моеноміцинів (5,7±0,6 мг/л ферментаційного середовища), ніж контрольний штам (2,3±0,3 мг/л ферментаційного середовища). Перевіряють стабільність підтримання плазміди pTESaadpA-exp у клітинах S. ghanaensis ATCC14672 за неселективних умов вирощування без використання селекції за стійкістю до + апраміцину. Для цього засівають штам S. ghanaensis pTESaadpA-exp у 30 мл середовища TSB та вирощують протягом 5 діб при 37 °C. Далі 300 мкл культури пересівають у нові колби з 30 мл TSB. Пересів повторюють три рази. 100 мкл культури з останнього пересіву послідовно 6 розводять стерильною водою у 10 разів та висівають клітини на вівсяне середовище без додавання апраміцину. У результаті на чашці Петрі виростає 200-500 колоній. Згодом методом реплік перевіряють стійкість однієї тисячі окремих клонів до апраміцину, аналізуючи їх на вівсяному середовищі з додаванням антибіотика у концентрації 50 мкг/мл. Усі проаналізовані + клони S. ghanaensis pTESaadpA-ехр зберігають фенотип стійкості до апраміцину та надсинтезують моеноміцини. Стовідсоткова стабільність успадкування плазміди та підвищений рівень синтезу антибіотика підтверджують отримання передбачуваного результату. ФОРМУЛА КОРИСНОЇ МОДЕЛІ 55 60 Спосіб підвищення продукції антибіотиків моеноміцинового ряду, який базується на надекспресії генів плейотропних регуляторів у актиноміцетах-продуцентах цих антибіотиків, який відрізняється тим, що як регуляторний елемент використовують ген плейотропного регулятора транскрипції adpAgh S. ghanaensis, клонований у складі інтегративної плазміди pTESaadpA-exp у штамах S. ghanaensis АТСС14672, S. lividans TK24, S. coelicolor M1152, S. albus J1074. 3 UA79968 U Комп’ютерна верстка В. Мацело Державна служба інтелектуальної власності України, вул. Урицького, 45, м. Київ, МСП, 03680, Україна ДП “Український інститут промислової власності”, вул. Глазунова, 1, м. Київ – 42, 01601 4

Дивитися

Додаткова інформація

Назва патенту англійською

Method for increasing of moenomycin antibiotics production

Автори англійською

Makitrynskyi Roman Pavlovych, Ostash Bohdan Omelianovych, Fedorenko Viktor Oleksandrovych, Tsypik Olha Volodymyrivna

Назва патенту російською

Способ повышения продукции антибиотиков моеномицинового ряда

Автори російською

Макитринский Роман Павлович, Осташ Богдан Емельянович, Федоренко Виктор Александрович, Ципик Ольга Владимировна

МПК / Мітки

МПК: C12Q 1/02, C12Q 1/00, C12Q 1/04

Мітки: продукції, моеноміцинового, спосіб, підвищення, антибіотиків, ряду

Код посилання

<a href="http://uapatents.com/6-79968-sposib-pidvishhennya-produkci-antibiotikiv-moenomicinovogo-ryadu.html" target="_blank" rel="follow" title="База патентів України">Спосіб підвищення продукції антибіотиків моеноміцинового ряду</a>

Подібні патенти