Спосіб прогнозування розвитку ішемічної хвороби серця у хворих на ревматоїдний артрит

Завантажити PDF файл.

Формула / Реферат

Спосіб прогнозування розвитку ішемічної хвороби серця (ІХС) у хворих на ревматоїдний артрит (РА), що включає проведення молекулярно-генетичних досліджень, який відрізняється тим, що дослідження проводять шляхом визначення генотипів за Bell поліморфізмом гена глюкокортикоїдного рецептора (ГР) і при наявності G/G та C/G генотипів роблять висновок про підвищений ризик, а С/С генотипу - про знижений ризик розвитку ішемічної хвороби серця у даних пацієнтів.

Текст

Реферат: UA 122754 U UA 122754 U 5 10 15 20 25 30 35 40 45 50 55 Корисна модель належить до галузі клінічної медицини, а саме до внутрішніх хвороб, ревматології, кардіології та медичної генетики, і може бути використана з метою прогнозування та профілактики ішемічної хвороби серця (ІХС) у хворих на ревматоїдний артрит (РА). Згідно з даними світової статистики, РА - розповсюджене захворювання запальної природи, яке вражає 0,5-1,0 % загальної популяції. Наявність РА значно прискорює летальність. При цьому смертність від усіх причин у хворих на РА зростає практично вдвічі, та приблизно 50 % визначається ІХС. Результати багатьох епідеміологічних та клінічних спостережень свідчать про те, що розповсюдженість ІХС в осіб із РА збільшена більш ніж на 40 %. Наявність ІХС при РА скорочує тривалість життя у середньому на 5-10 років, а частота розвитку інфаркту міокарда (IМ) у хворих на РА з тривалістю більше 10 років підвищена по меншій мірі вдвічі. У пацієнтів із РА порівняно із загальною популяцією відмічається значна перевага частоти розвитку таких ускладнень ІХС, як IМ, застійної серцевої недостатності, коронарної смерті. Частота смертності від гострого коронарного синдрому в осіб із РА досягає 40 % порівняно з 15 % у загальній популяції, а повторний розвиток кардіоваскулярних явищ у межах 3 міс. складає відповідно 57,5 і 30 % [Коваленко В.Н. Особенности патогенеза и клинического течения атеросклероза у больных с системными воспалительными заболеваниями [Електронний ресурс] /В.Н. Коваленко, Т.В. Талаева, Е.А. Гармиш, В.В. Братусь //УКРКАРДІО український кардіологічний портал. 09. 2011. Режим доступу до порталу: http://www.ukrcardio.org/journal.php/page/4.]. При РА відзначається підвищення летальності від серцево-судинних катастроф у 2 рази. Результати численних досліджень демонструють суттєвий ріст ризику розвитку серцевосудинних подій у хворих на ΡА. Так, ризик смерті від інфаркту міокарду зростає у 2-4 рази, від гострих порушень мозкового кровообігу - в 1,5-2 рази у порівнянні із загальною популяцією. Ризик смерті прослідковується навіть у дебюті РА та асоціюється із серопозитивністю за ревматоїдним фактором (РФ) [Головач І.Ю. Науково обґрунтовані рекомендації EULAR (2010) щодо менеджменту серцево-судинного ризику в пацієнтів із ревматоїдним артритом і запальними артритами /І.Ю. Головач //Укр. ревматол. журн. - 2011. - № 44 (2). – С. 5-13]. При цьому роль класичних кардіоваскулярних факторів ризику, таких як артеріальна гіпертензія, гіперліпідемія, ожиріння, цукровий діабет, куріння у виникненні несприятливих клінічних ефектів у популяції пацієнтів із РА зберігається. З іншого боку, частоту серцево-судинних ускладнень неможливо пояснити лише накопиченням традиційних чинників ризику. Суттєву роль у розвитку кардіоваскулярної летальності у популяції хворих па РА відіграє прогресування атеросклерозу внаслідок безпосереднього негативного впливу хронічного запального процесу [Березин А.Е. Ревматоидный артрит и кардиоваскулярный риск /А.Е. Березин //Український ревматологічний журнал. - 2013. - № 52 (2). – С. 23-29]. Існує ряд досліджень щодо зв'язку РА, кардіоваскулярного ризику та чинників ІХС із генетичними детермінантами, зокрема - із Bell поліморфізмом гена глюкокортикоїдного рецептора (ГР) [Клиническое значение BclI-полиморфизма гена глюкокортикоидного рецептора у детей с ювенильным идиопатическим артритом /М.М. Костик, Д.Н. Баранов, А.А. Козырева [и др.] //Вопросы практ. педиатрии. - 2008. - № 6 (3). - С. 8-11; Influence of Bcl-1 gene polymorphism of glucocorticoid receptor gene (NR3C1, rs41423247) on blood pressure, glucose in Northernlndians. Indian /N. Srivastava, J. Prakash, R. Lakhan [et al.] //J. Clin. Biochem. - 2011. - Vol. 26. - № 2. - P. 125-130.]. Встановлено, що у носіїв G алелі із тяжким ожирінням зареєстровані вищі показники систолічного і діастолічного артеріального тиску, загального холестерину та холестерину ліпопротеїдів низької щільності (ХС ЛПНЩ) [The relation between two polymorphisms in the glucocorticoid receptor gene and body mass index, blood pressure and cholesterol in obese patients /A.M. Di Blasio, E.F. van Rossum, S. Maestrini [et al.] //J. Steroid Biochem. Моl. Biol. - 2009. - Vol. 113. - № 3-5. - P. 269-274.]. Доведено зв'язок Bell поліморфізм із вищим на 34 % ризиком серцево-судинних захворювань та із ендотеліальною дисфункцією, яка є раннім маркером атеросклерозу [Endocrine research two common haplotypes of the glucocorticoid receptor gene are associated with increased susceptibility to cardiovascular disease in men with familial hypercholesterolemia /K.C.M.C. Koeijvoets, J.B. van der Net, E.F.C. van Rossum [et al.] //Home. 2008. - Vol. 93. - № 12. - P. 4902-4908.; Subjects homozygous for the BCL1 polymorphism of glucocorticoid receptor gene may have an increased risk for impaired endothelial function / K. Stamatelopoulos, K. Saltiki, E. Mantzou [et al.] //Endocrine Abstracts. - 2010. - Vol. 22. - P. 127.]. Виявлено вищу частоту Bell поліморфізму гена ГР у хворих на ІХС порівняно із групою контролю [Bell polymorphysm of glucocorticoid receptor gene in coronary artery disease /B. Popovic, D. Macut, T. Isailovic [et al.] //Endocrine Abstracts. - 2010. - Vol. 22. - P. 169.]. 1 UA 122754 U 5 10 15 20 25 30 35 40 45 50 55 60 Відомий спосіб визначення ліпідних порушень у хворих на ішемічну хворобу серця, що включає дослідження жирнокислотного складу фосфоліпідів мембран еритроцитів та ліпідного складу сироватки крові. Методом газорідинної хроматографії визначають склад ессенціальних жирних кислот: лінолевої та арахідонової, розраховують їх співвідношення з контролем за формулою: k = С18:2/С20:4, де k - коефіцієнт, С 18:2 - лінолева кислота. С20:4 - арахідонова кислота, і при зниженні отриманих показників (k < 5-6) визначають ліпідні порушення [UA53533, МПК G01 N33/48. дата публікації: 15.01.03, бюл. № 1]. Недолік даного методу діагностики полягає в тому, що він дозволяє діагностувати захворювання лише постфактум і не забезпечує прогнозування його розвитку у стадіях, що передують захворюванню. Найбільш близьким до запропонованого, а тому прийнятим за прототип, є спосіб прогнозування раннього розвитку ішемічної хвороби серця, що включає дослідження, як фактору ризику, імуногенетичних маркерів HLA системи і при наявності алелів HLA-DRBT11 та DQB 1*0201 судять про високий ризик раннього розвитку ішемічної хвороби серця, [пат. № 50185, U, UA, МПК G01N 33/53, А61В 5/026, опубл. 25.05.2010, бюл. № 10]. Недоліком вибраного прототипу можна назвати прогнозування розвитку ІХС у популяції, що не дає вірогідних даних щодо розвитку захворювання в осіб із РА. В основу корисної моделі поставлено задачу розробити спосіб прогнозування ризику розвитку ІХС у хворих на РА шляхом визначення генотипів за Bell поліморфізмом гена ГР, що дозволить більш інформативно та з меншими затратами сформувати групи високого ризику для того, щоб здійснити заходи з профілактики даної патології. Поставлена задача вирішується тим, що у відомому способі прогнозування ІХС серед пацієнтів із РА, що включає проведення молекулярно-генетичних досліджень, згідно із корисною моделлю, дослідження проводять шляхом визначення генотипів за Всі 1 поліморфізмом гена ГР і при наявності G/G та C/G генотипів роблять висновок відносно підвищеного ризику, а С/С зниженого ризику розвитку ІХС у даних хворих. Виконання способу прогнозування розвитку ІХС у хворих на РА, що заявляється, з усіма суттєвими ознаками, включаючи відмінні, дозволяє по оцінці результатів наявності G/G та C7G генотипів сформувати групи ризику серед пацієнтів для ранньої профілактики захворювання. Таким чином, визначення генотипів за Bell поліморфізмом гена ГР, а саме G/G та C/G генотипів, надає можливість прогнозування розвитку ІХС у хворих на РА до клінічних проявів хвороби. Спосіб пояснюється рисунком, на якому показано результати рестрикційного аналізу Bell (C+647G) поліморфізму гена глюкокортикоїдного рецептора. Μ - маркер молекулярної маси (по пари нуклеїнових основ); доріжки 5,6,7 відповідають С/С генотипу; доріжки 1,3,8,10,11,12-C/G генотипу; 2,4,9-G/G генотипу. Спосіб виконують наступним чином: венозну кров набирають в стерильних умовах у моновети об'ємом 2,7 мл з калієвою сіллю етилендіамінтетраоцтової кислоти (11,7 мМ) в якості антикоагулянту ("Sarstedt", Німеччина), заморожують та зберігають при температурі -20 °C. Виділення ДНК із лейкоцитів цільної крові здійснюють за допомогою лізуючого реагенту із гуанідинізоціонатом методом полімеразної ланцюгової реакції (ПЛР) з наступним аналізом довжини рестрикційних фрагментів (PCR-RFLP) за Fleury I. et al. із модифікаціями. Для цього ампліфікували ділянку промотора вказаного гена за допомогою пари специфічних праймерів: прямого (sence)-5'AAATTGAAGCTTAACAATTTTGGC 3' і зворотного (antisense) 5'GCAGTGAACAGTGTACCAGACC 3'. Праймери було синтезовано фірмою "Metabion" (Німеччина). Для ампліфікації брали 50-100 нг ДНК і додавали до суміші, що містила 5 мкл 5кратного PCR-буферу, 1,5 мМ сульфату магнію, 200 мкМ суміші чотирьох нуклеотидтрифосфатів, по 20 рМ кожного з праймерів і 0,75 ОД Taq-полімерази ("Ферментас", Литва), об'єм доводили до 25 мкл деіонізованою водою. PCR проводили в термоциклері GeneAmp PCR System 2700 ("Applied Biosystems", США). Ампліфікація фрагмента 2-го екзону складалася з 33 циклів: денатурація - 94 °C (50 с), гібридизація праймерів -64,5 °C (45 с) і елонгація - 72 °C (1 хв). Потім 6 мкл продукту ампліфікації інкубували при 37 °C протягом 18 годин з 3 ОД рестриктази Bell (Ksp221) ("Ферментас", Литва) у буфері G такого складу: 10 мМ трис-НСІ (рН 7,5), 10 мМ хлориду магнію, 50 мМ NaCI і 0,1 мг/мл альбуміну. Якщо в 647 позиції гена GR містився цитозин, ампліфікат, який складався з 206 пар основ, розщеплювався рестриктазою Bell на два фрагменти - 1 16 і 90 пар основ. У разі заміни цитозину на гуанін сайт рестрикції для Bell втрачався і утворювався один фрагмент розміром 206 пар основ.Ампліфікати після рестрикції розділяли в 2,5 % агарозному гелі, що містив 10 мкг/мл бромистого етидію. Горизонтальний електрофорез (0,13 А; 200 V) проводили протягом 25 хв. Візуалізацію ДНК після електрофорезу здійснювали за допомогою трансілюмінатора ("Біоком", Росія). Запропонованим способом було проведено обстеження 161 пацієнта із РА. Контрольну групу склали 96 практично здорових осіб. Діагноз РА встановлено згідно з діагностичними 2 UA 122754 U 5 10 критеріями ACR/EULAR (2010), а ІХС - Наказу № 436 та № 152 МОЗ України. Пацієнтів було поділено на 2 групи: 76 (47,2 %) хворих на РА без супутньої ІХС (І група) та 85 (52,8 %) - у поєднанні з ІХС (II група). Статистичну обробку отриманих даних проводили за допомогою програми SPSS 17. Для порівняння розподілу алельних варіантів між групами хворих та контролю використовували 2 критерій  - Пірсона. Про асоціацію генотипів зі схильністю до захворювань оцінювали за величиною відношення шансів (ВШ) з 95 % довірчим інтервалом (ДІ). Статистично достовірними вважали відмінності при ρ (показник вірогідності відмінностей) < 0,05. Результати молекулярно-генетичного аналізу Bell поліморфізму гена ГР в досліджуваних групах наведено в таблиці. Таблиця Частота генотипів за Bell поліморфізмом гена глюкокортикостероїдпою рецептора у хворих на ревматоїдний артрит Генотип С/С C/G G/G 2  =15,23; Р=0,02 І група, n=76 n 29 39 8 II група, n=85 % 64,4 49,4 21,6 n 16 40 29 % 35,6 50,6 78,4 Примітки: 2 1.  - критерій Пірсона; 2. Ρ - значимість відмінностей у розподілі генотипів у хворих І та II груп. 15 20 Як видно із таблиці, G/G генотип вірогідно частіше зустрічався у хворих II групи, а С/С генотип - у пацієнтів І групи (р=0,02). Ризик розвитку ІХС серед пацієнтів із РА у гомозигот за G алелем (ВШ=6,57, 95 % ДI 2,43-17,73; p=0,001) та у гетерозигот (C/G) (ВШ=3,53, 95 % ДІ 1,448,68; p=0,006) у 6,57 і 3,53 разів відповідно вищий відносно гомозигот за С алелем. Технічним результатом, що досягається запропонованим способом, є прогнозування ризику розвитку ІХС у хворих на ΡA із G/G та C/G генотипами за Bell поліморфізмом гена ГР, що дозволяє сформувати групи ризику щодо розвитку ІХС. Для таких осіб можна рекомендувати контроль факторів ризику серцево-судинних захворювань, корекцію способу життя шляхом проведення профілактичних заходів, що дозволило б суттєво знизити ризик розвитку ІХС. ФОРМУЛА КОРИСНОЇ МОДЕЛІ 25 30 Спосіб прогнозування розвитку ішемічної хвороби серця (ІХС) у хворих на ревматоїдний артрит (РА), що включає проведення молекулярно-генетичних досліджень, який відрізняється тим, що дослідження проводять шляхом визначення генотипів за Bell поліморфізмом гена глюкокортикоїдного рецептора (ГР) і при наявності G/G та C/G генотипів роблять висновок про підвищений ризик, а С/С генотипу - про знижений ризик розвитку ішемічної хвороби серця у даних пацієнтів. 3 UA 122754 U Комп’ютерна верстка В. Мацело Міністерство економічного розвитку і торгівлі України, вул. М. Грушевського, 12/2, м. Київ, 01008, Україна ДП “Український інститут інтелектуальної власності”, вул. Глазунова, 1, м. Київ – 42, 01601 4

Дивитися

Додаткова інформація

Автори англійською

Prystupa Liudmyla Nykodymivna

Автори російською

Приступа Людмила Никодимовна

МПК / Мітки

МПК: G01N 33/53

Мітки: спосіб, артрит, розвитку, хворих, ревматоїдний, хвороби, серця, ішемічної, прогнозування

Код посилання

<a href="http://uapatents.com/6-122754-sposib-prognozuvannya-rozvitku-ishemichno-khvorobi-sercya-u-khvorikh-na-revmatodnijj-artrit.html" target="_blank" rel="follow" title="База патентів України">Спосіб прогнозування розвитку ішемічної хвороби серця у хворих на ревматоїдний артрит</a>

Подібні патенти