Спосіб визначення присутності trichomonas tenax у досліджуваному зразку та набір праймерів для його здійснення

Номер патенту: 107910

Опубліковано: 25.02.2015

Автори: Федорич Павло Володимирович, Зелений Сергій Борисович

Завантажити PDF файл.

Формула / Реферат

1. Спосіб визначення присутності Trichomonas tenax у досліджуваному зразку методом полімеразної ланцюгової реакції, який відрізняється тим, що при проведенні полімеразної ланцюгової реакції як набір праймерів використовують прямий і зворотний праймери для детекції Trichomonas tenax нуклеотидного складу:

CCATCGATGCCATTCGGTATTG (SEQ ID NО:1) та

CTTCGTCTAAGTCCTTAGATGCAAG (SEQ ID NО:2),

як інкубаційну суміш використовують склад, кінцевим об'ємом 35 мкл, що включає: 6 мМ Tris-HCl (рН 8,5, 25 °С), 3 мМ MgSO4, 2,5 мМ МgСl2, 2 мМ dNTP, 10 рМ праймерів, 1 нг ДНК матриці, 1 од. Taq-ДНК полімерази та буфер Tween-20,

ампліфікацію здійснюють за програмою: 94 °С - 2 хв. - 1 цикл, 94 °С - 30 с, 59 °С - 20 с - 5 циклів, 72 °С - 25 с, 94 °С - 10 с, 62 °С - 10 с - 45 циклів, 72 °С -20 с,

при цьому ампліфікацію і детекцію Trichomonas tenax здійснюють в режимі реального часу.

2. Набір праймерів для детекції Trichomonas tenax, що включає прямий і зворотний праймери нуклеотидного складу:

CCATCGATGCCATTCGGTATTG (SEQ ID NО:1) та

CTTCGTCTAAGTCCTTAGATGCAAG (SEQ ID NО:2).

Текст

Дивитися

Реферат: Винахід належить до мікробіології та медицини і може бути використаний для виявлення Trichomonas tenax при діагностиці та лікуванні трихомоніазу. Спосіб включає проведення полімеразної ланцюгової реакції. Як набір праймерів використовують прямий і зворотний праймери для детекції Trichomonas tenax нуклеотидного складу: CCATCGATGCCATTCGGTATTG (SEQ ID NО:1) та CTTCGTCTAAGTCCTTAGATGCAAG (SEQ ID UA 107910 C2 (12) UA 107910 C2 NО:2). Заявлений спосіб є чутливим і специфічним і забезпечує високу точність виявлення трихомонад Trichomonas tenax. UA 107910 C2 5 10 15 20 25 30 35 40 45 50 55 60 Винахід належить до мікробіології, вірусології, молекулярної біології та медицини і може бути використаний для виявлення Trichomonas tenax при діагностиці та лікуванні трихомоніазу. Трихомоніаз, що є захворюванням сечостатевої системи, викликається найпростішим одноклітинним паразитом Trichomonas vaginalis і передається переважно статевим шляхом або, в окремих випадках, шляхом контамінації (Адаскевич В.П. Инфекции, передаваемые половым путем. - Μ.: Медицинская книга. - 2006. - 425 с. [1]). Щорічно у світі захворювання трихомоніазом діагностується приблизно у 170 млн. випадків (Туркевич О.Ю. Деякі питання етіопатогенетичного обґрунтування комплексного лікування бактеріального вагінозу. /Український журнал дерматології, венерології, косметології. - Київ, 2010, № 1 (36), - С. 92-96 [2]). Це захворювання не має сезонного характеру та здатне вражати усі шари населення. Вважається, що трихомонада, що здатна існувати у урогенітальному тракті, є Trichomonas vaginalis. Однак, здатність найпростіших до патоморфозу та, з іншого боку, суттєві зміни стереотипу сексуальної поведінки сучасної людини, зокрема, збільшення практики орального та анального сексу, - призвели до можливості існування у урогенітальному тракті іншого типу трихомонад, а саме Trichomonas tenax. З рівня техніки відомі способи діагностики трихомоніазу, що базуються на фазовоконтрастній мікроскопії, зокрема: Клименко Б.В. Трихомониаз. - Л.: Медицина, 1987 [3], UA, патент на корисну модель № 39256 U [4], RU, 2466731 [5], - проте, чутливість цього методу є недостатньо високою (не перевищує 65 %). Відомі способи діагностики трихомоніазу методом полімеразної ланцюгової реакції, зокрема: L.F. Lawing, S.R.Hedgers, J.R.Schwebke. Detection of Trichomonosis in Vaginal and Specimens from Woman by Culture and PCR (Journal of clinical microbiology. - 2000. - v. 38, N. 10-p. 3585-3588 [6]), RU, патент № 2389016 ([7]). В основі методу полімеразної ланцюгової реакції лежить можливість збільшити малі концентрації визначених фрагментів нуклеїнової кислоти ДНК у біологічному матеріалі шляхом багатократного вибіркового копіювання визначеної ділянки нуклеїнової кислоти ДНК за допомогою ферменту у штучних умовах. При цьому, за допомогою набора праймерів: прямого і зворотного, відбувається копіювання тільки тієї ділянки ДНК-матриці, яка задовольняє заданим умовам, і тільки у тому випадку, якщо ця ділянка присутня у досліджуваному зразку. Молекулярно-генетичні методи діагностики трихомоніазу є більш чутливими, розробка їх пов'язана з підбором компонентів реакції: вибір праймерів, комплементарних протилежним кінцям різних ланцюгів потрібного фрагмента ДНК, складу інкубаційної суміші, - а також підбору програми ампліфікації. Проте, відомі способи діагностики трихомоніазу методом полімеразної ланцюгової реакції також не забезпечують потрібної чутливості, причому, проблема не тільки у виборі компонентів для проведення ампліфікації і її умов, а також і в тому, що у зазначених способах здійснюється ідентифікація тільки трихомонад Trichomonas vaginalis. Актуальність виявлення трихомонад типу Trichomonas tenax у сечостатевій системі пацієнтів, хворих на інфекції, що передаються статевим шляхом, пов'язана як з високим рівнем захворювання трихомоніазом, так і з можливістю більш точного діагностування трихомоніазу і, в результаті, проведення більш спрямованого лікування, що підвищує його ефективність. Найбільш близьким є спосіб визначення присутності Trichomonas tenax у досліджуваному зразку методом полімеразної ланцюгової реакції (міжнародна заявка PCT/US2011/062933 [8]). За даним способом присутність Trichomonas tenax у досліджуваному зразку визначається опосередковано, оскільки методом полімеразної ланцюгової реакції здійснюють визначення Trichomonas vaginalis, однак, при визначенні цього виду трихомонад враховують присутність Trichomonas tenax, отриману експериментально-розрахунковим шляхом за молекулярногенетичними даними, отриманими за допомогою 6-ти штамів Trichomonas vaginalis і одного штаму Trichomonas tenax. Однак, такий спосіб не дає можливості отримати точні результати щодо наявності Trichomonas tenax у досліджуваному зразку, що негативно впливає на діагностування трихомоніазу та ефективність його лікування. Задачею винаходу є удосконалення способу визначення присутності Trichomonas tenax у досліджуваному зразку, в якому за рахунок підібраних праймерів і умов здійснення ампліфікації забезпечується точність у виявленні наявності трихомонад Trichomonas tenax. Задачею винаходу є також створення набора праймерів для детекції Trichomonas tenax, що дозволяє отримати дані щодо присутності Trichomonas tenax у досліджуваному зразку в режимі реального часу. Поставлена задача вирішується запропонованим способом визначення присутності Trichomonas tenax у досліджуваному зразку методом полімеразної ланцюгової реакції, в якому 1 UA 107910 C2 5 10 15 20 25 30 35 40 45 50 55 60 при проведенні полімеразної ланцюгової реакції як набір праймерів, використовують прямий і зворотний праймери для детекції Trichomonas tenax нуклеотидного складу: CCATCGATGCCATTCGGTATTG (SEQ ID NО:1) та CTTCGTCTAAGTCCTTAGATGCAAG (SEQ ID NО:2), як інкубаційну суміш використовують склад, кінцевим об'ємом 35 мкл, що включає: 6 мМ Tris-HCl (рН 8,5, 25 °C), 3 мМ MgSO4, 2,5 мМ МgСl2, 2 мМ dNTP, 10 рМ праймерів, 1 нг ДНК матриці, 1 од. Taq-ДНК полімерази та буфер Tween-20, ампліфікацію здійснюють за програмою: 94 °C-2 хв. - 1 цикл, 94 °C-30 с, 59 °C-20 с - 5 циклів, 72 °C-25 с, 94 °C-10 с, 62 °C-10 с - 45 циклів, 72 °C-20 с, при цьому ампліфікацію і детекцію Trichomonas tenax здійснюють в режимі реального часу. Поставлена задача вирішується також набором праймерів для детекції Trichomonas tenax, що включає прямий і зворотний праймери нуклеотидного складу: CCATCGATGCCATTCGGTATTG (SEQ ID NО:1) та CTTCGTCTAAGTCCTTAGATGCAAG (SEQ ID NО:2). Експериментально підібраний нами авторський діагностикум, що був створений спеціально для визначення присутності Trichomonas tenax у досліджуваному зразку методом полімеразної ланцюгової реакції, за рахунок підібраного набору праймерів для детекції Trichomonas tenax (олігонуклеотиди SEQ ID NО:1 та SEQ ID NО:2), підібраного складу інкубаційної суміші та підібраної програми аплікації дозволив отримати точні дані щодо присутності Trichomonas tenax у досліджуваному зразку. Набір праймерів для детекції Trichomonas tenax був підібраний з послідовності нуклеїнових кислот Trichomonas tenax gene for SrRNA, отриманих з бази даних "GenBank" Ref. D49495.1 (http://blast.ncbi.nlm.nih.gov/ [9]). Для перевірки унікальності праймерів використовувалася on-line програма (www.ucsc.edu [10]). Спосіб визначення присутності Trichomonas tenax у досліджуваному зразку методом полімеразної ланцюгової реакції здійснюється таким чином. Здійснюють забір біологічного матеріалу для дослідження на присутність Trichomonas tenax. Досліджуваний зразок вводять в контакт з інкубаційною сумішшю кінцевим об'ємом 35 мкл, що включає: 6 мМ Tris-НСl (рН 8,5, 25 °C), 3 мМ MgSO4, 2,5 мМ МgСl2, 2 мМ dNTP, 10 рМ праймерів, 1 нг ДНК матриці, 1 од. Taq-ДНК полімерази та буфер Tween-20, де як набір праймерів, використовують прямий праймер CCATCGATGCCATTCGGTATTG (SEQ ID NО:1) і зворотний праймер CTTCGTCTAAGTCCTTAGATGCAAG (SEQ ID NО:2). У реакційну суміш додають барвник і переносять в умови, придатні для ампліфікації, детектуючий ампліфікатор. Проведення ампліфікації здійснюють за програмою: 94 °C-2 хв. - 1 цикл, 94 °C-30 с, 59 °C-20 с 5 циклів, 72 °C-25 с, 94 °C-10 с, 62 °C-10 с -45 циклів, 72 °C-20 с Проведення ампліфікації і детекції Trichomonas tenax здійснюють в режимі реального часу. Відомості, що підтверджують можливість здійснення винаходу. Нами у м. Києві (Україна) у період 2013-2014 року здійснювався запропонований спосіб визначення присутності Trichomonas tenax у досліджуваному зразку. Дослідження проводилися на групі пацієнтів за їх згодою, що звернулися до дерматовенерологічної установи на обстеження з приводу інфекцій, що передаються переважно статевим шляхом. Для чистоти дослідження у цю групу були відібрані тільки ті пацієнти, у яких методом полімеразної ланцюгової реакції було виключено інфікування Trichomonas vaginalis. Група складалася з 72 пацієнтів, серед яких 30 жінок (41,7 %) і 42 чоловіки (58,3 %). Вік пацієнтів - від 20 до 65 років, у середньому - 32 роки). У всіх пацієнтів було встановлено хронічне протікання урогенітальної інфекції. Забір біологічного матеріалу для дослідження на присутність Trichomonas tenax здійснювався у відповідності до діючих рекомендацій (Мавров I.I. Уніфікація лабораторних методів дослідження в діагностиці захворювань, що передаються статевим шляхом. /І.І. Мавров, О.П. Белозоров, Л.С. Тацька. - Харків: Факт. - 2000. - 120 с [11]). У чоловіків брали зскрібки з уретри одноразовими зондами і забір секрету передміхурової залози після її пальцьового масажу, у жінок брали забір піхвових виділень, а також зскрібки з уретри і цервікального каналу. Досліджуваний зразок вводили в контакт з інкубаційною сумішшю кінцевим об'ємом 35 мкл, що включала: 6 мМ Tris-HCI (рН 8,5, 25 °C), 3 мМ MgSO4, 2,5 мМ МgСl2, 2 мМ dNTP, 10 рМ праймерів, 1 нг ДНК матриці, 1 од. Taq-ДНК полімерази та буфер Tween-20. Як набір праймерів, використовували: CCATCGATGCCATTCGGTATTG (SEQ ID No:1) і CTTCGTCTAAGTCCTTAGATGCAAG (SEQ ID NO:2). У реакційну суміш додавали барвник: N'N'диметил-N-[4-[(Е)-(3-метил-1,3-бензотіазол-2-уліден)метил]-1-фенілхінолін-1-фум-2-іл]-Nпропілпропан-1,3-діамін (ціаніновий барвник SYBR Green І), і переносили у детектуючий ампліфікатор ДТ-96 (виробник - "ДНК-Технологія", Росія). Проведення ампліфікації здійснювали 2 UA 107910 C2 5 за програмою: 94 °C-2 хв. - 1 цикл, 94 °C-30 с, 59 °C-20 с - 5 циклів, 72 °C-25 с, 94 °C-10 с, 62 °C10 с - 45 циклів, 72 °C-20 с Проведення ампліфікації і детекції Trichomonas tenax здійснювали в режимі реального часу. В результаті Trichomonas tenax був виявлений у 23 пацієнтів (32 %), а саме: у 13 жінок (56,5 % пацієнтів) і у 10 чоловіків (43,5 %) (рисунок). Призначене в результаті виявленого типу трихомонад лікування, специфічного до Trichomonas tenax, виявилося ефективним. Заявлений спосіб визначення присутності Trichomonas tenax у досліджуваному зразку методом полімеразної ланцюгової реакції є чутливим і специфічним і забезпечує високу точність виявлення наявності трихомонад Trichomonas tenax. 10 ФОРМУЛА ВИНАХОДУ 15 20 25 1. Спосіб визначення присутності Trichomonas tenax у досліджуваному зразку методом полімеразної ланцюгової реакції, який відрізняється тим, що при проведенні полімеразної ланцюгової реакції як набір праймерів використовують прямий і зворотний праймери для детекції Trichomonas tenax нуклеотидного складу: CCATCGATGCCATTCGGTATTG (SEQ ID NО:1) та CTTCGTCTAAGTCCTTAGATGCAAG (SEQ ID NО:2), як інкубаційну суміш використовують склад, кінцевим об'ємом 35 мкл, що включає: 6 мМ TrisHCl (рН 8,5, 25 °С), 3 мМ MgSO4, 2,5 мМ МgСl2, 2 мМ dNTP, 10 рМ праймерів, 1 нг ДНК матриці, 1 од. Taq-ДНК полімерази та буфер Tween-20, ампліфікацію здійснюють за програмою: 94 °С - 2 хв. - 1 цикл, 94 °С - 30 с, 59 °С - 20 с - 5 циклів, 72 °С - 25 с, 94 °С - 10 с, 62 °С - 10 с - 45 циклів, 72 °С -20 с, при цьому ампліфікацію і детекцію Trichomonas tenax здійснюють в режимі реального часу. 2. Набір праймерів для детекції Trichomonas tenax, що включає прямий і зворотний праймери нуклеотидного складу: CCATCGATGCCATTCGGTATTG (SEQ ID NО:1) та CTTCGTCTAAGTCCTTAGATGCAAG (SEQ ID NО:2). Комп’ютерна верстка Л. Бурлак Державна служба інтелектуальної власності України, вул. Урицького, 45, м. Київ, МСП, 03680, Україна ДП “Український інститут промислової власності”, вул. Глазунова, 1, м. Київ – 42, 01601 3

Додаткова інформація

Автори англійською

Fedorych Pavlo Volodymyrovych

Автори російською

Федорич Павел Владимирович

МПК / Мітки

МПК: C12Q 1/04, C12Q 1/68, C12N 15/11

Мітки: tenax, спосіб, праймерів, набір, зразку, здійснення, визначення, присутності, trichomonas, досліджуваному

Код посилання

<a href="http://uapatents.com/5-107910-sposib-viznachennya-prisutnosti-trichomonas-tenax-u-doslidzhuvanomu-zrazku-ta-nabir-prajjmeriv-dlya-jjogo-zdijjsnennya.html" target="_blank" rel="follow" title="База патентів України">Спосіб визначення присутності trichomonas tenax у досліджуваному зразку та набір праймерів для його здійснення</a>

Подібні патенти