Молекула нуклеїнової кислоти, що кодує істотно нетоксичний мутеїн альфа-токсину clostridium perfringens, та істотно нетоксичний мутеїн альфа-токсину clostridium perfringens

Номер патенту: 109105

Опубліковано: 27.07.2015

Автори: Лер Стівен В., Кочран Марк Д., Петерсен Гарі, Синенкі Річард

Є ще 26 сторінок.

Дивитися все сторінки або завантажити PDF файл.

Формула / Реферат

1. Молекула нуклеїнової кислоти, що кодує істотно нетоксичний мутеїн альфа-токсину Clostridium perfringens, де мутеїновий альфа-токсин містить амінокислотну послідовність SEQ ID NO: 3 мінус 9 послідовних амінокислотних залишків; та де одним з делетованих амінокислотних залишків є His68.

2. Молекула нуклеїнової кислоти за пунктом 1, де мутеїновий альфа-токсин містить SEQ ID NO: 3 мінус 9 послідовних амінокислотних залишків у діапазоні від Tyr62 до Trp70.

3. Молекула нуклеїнової кислоти за пунктом 2, що містить нуклеотидну послідовність SEQ ID NO: 2; де нуклеотиди 268-294 молекули нуклеїнової кислоти делетовано.

4. Молекула нуклеїнової кислоти за пунктом 3, де делетовані нуклеотиди заміщені нуклеотидною послідовністю, що кодує одинарний Leu залишок.

5. Істотно нетоксичний мутеїн альфа-токсину Clostridium perfringens, де мутеїновий альфа-токсин містить амінокислотну послідовність SEQ ID NO: 3 мінус 9 послідовних амінокислотних залишків; та де одним з делетованих амінокислотних залишків є His68.

6. Істотно нетоксичний мутеїн альфа-токсину Clostridium perfringens за пунктом 5, де мутеїновий альфа-токсин містить амінокислотну послідовність SEQ ID NO: 3 мінус 9 послідовних амінокислотних залишків у діапазоні від Tyr62 до Trp70.

7. Істотно нетоксичний мутеїн альфа-токсину Clostridium perfringens за пунктом 6, де дев'ять послідовних амінокислотних залишків, що знаходяться у діапазоні від Tyr62 до Trp70, делетовано та заміщено одинарним Leu залишком.

Текст

Дивитися

Реферат: У даному винаході описана молекула нуклеїнової кислоти, що кодує практично нетоксичний мутеїн альфа-токсину Closthdium perfringens. Практично нетоксичний мутеїн альфа-токсину Clostridium perfringens містить амінокислотну послідовність SEQ ID NO: 3 без дев'яти послідовних амінокислотних залишків, зокрема послідовних амінокислотних залишків у діапазоні від Tyr62 до Trp70; та де одним з делетованих амінокислотних залишків є His68. UA 109105 C2 (12) UA 109105 C2 UA 109105 C2 5 10 15 20 25 30 35 40 45 50 55 Ця заявка є не попередньою заявкою, де заявлено пріоритет відповідно до статті 35 U.S.С § 119(е) попередньої заявки США № 60/792,553, поданої 17 квітня 2006 p., зміст якої повністю включено до цієї заявки шляхом посилання. Даний винахід стосується атенуйованих організмів Clostridium, способів їх одержання та використання, та мутантних альфа-токсинів та нуклеїнових кислот, що їх кодують. Анаеробні бактеріальні патогени являють собою серйозне економічне навантаження на сільськогосподарське виробництво. Бактерії сімейства Clostridium призводять до особливих витрат, оскільки ці бактерії викликають серйозні хвороби у птахів та інших домашніх тварин, цінних з економічної точки зору. Попередні спроби контролю цих організмів були засновані на санітарних заходах та введенні антибіотиків у їжу тварин. Зокрема, Clostridium perfringens ("С. perfringens") є анаеробною бактерією, що зустрічається у ґрунті, загниваючих органічних речовинах, та є частиною флори кишок людей та тварин. Різні штами С. perfringens позначені як біотипи А - Е, залежно від діапазону токсинів, що виробляють [Justin et a/., Biochemistry 41, 6253-6262 (2002); McDonel (1986) Pharmacology of Bacterial TOXINS; F Drnеr та J Drews (Eds.) Pergamon Press, Oxford]. Штами біотипу А є особливо важливими як етіологічні агенти різних видів гангрени та кишкових захворювань. Особливо серйозною кишковою хворобою, що викликають С. perfringens є ентерит некротичний (також відомий у цій галузі як "некротичний ентерит"), гангрена кишечнику, що призводить до некрозу, сепсису та гемолізу, як у людей, так і у домашніх тварин [awe., Pearson et al., J. Am. Vet. Med. 188(11): 1309-10 (1986); Al-Sheikhy and Truscott, Avian Dis. 21 (2):256-63 (1977)]. Для птахів, наприклад, курей (Gallus gallus), некротичний ентерит є значною проблемою. С. perfringens типу А чи типу С може спричинити великі витрати, особливо при одержанні бройлерних курей [Ficken and Wages, Necrotic Enteritis, у Diseases of Poultry, 10th Ed. pps 261-264 (1997)]. Крім втрат, пов'язаних із спалахами некротичного ентериту, повідомлялося про погіршення продуктивності овець з хворобою, пов'язаною з С. perfringens [Lovl and Kaldhusdal, Avian Pathology 30:73-81 (2001)]. Як відмічено вище, антибактеріальні агенти, введені у корм тварин, є найбільш розповсюдженим способом контролю. Проте, антибактеріальні агенти, наприклад, антибіотики, є дорогими та на них впливають багато факторів, пов'язаних із підвищенням стійкості до бактерій. Нещодавно було здійснено спроби забезпечення вакцини проти шкідливих видів Clostridium. Наприклад, Lovland et al. [Avian Pathology 33(1):83-92 (2004)] продемонстрували кандидатні вакцини, засновані на С. perfringens типу А та типу С токсоїдах з наповнювачем - гідроксидом алюмінію. Вакцинація батьківських курей, як повідомлялося, забезпечує специфічні антитіла для захисту потомства від зовнішніх пошкоджень, викликаних субклінічними ін'єкціями С. perfringens. Відомі інші вакцини на основі таксоїдів, одержані з детоксифованих токсинів С. perfringens [див. наприклад, Патент США № 4,292,307, де описано токсоїди С. perfringens типів А, В та D, СІ. oedematiens, та СІ. septicum]. Також були запропоновані рекомбінантні токсоїдні препарати. Наприклад, Titball et al., [Патенти США №№ 5,851,827, 6,403,094, та 5,817,317] повідомляють про нуклеїнові кислоти, що кодують антигенні пептиди С. perfringens, а також пептиди як такі, та вакцини, одержані з пептидів. Наприклад, описано пептиди, що мають амінокислотні залишки 261-300 природного альфа-токсину С. perfringens, але в яких відсутня фосфоліпаза С та домени сфінгомієлін гідролізинів природного токсину. Додатково повідомлялося, що ці пептиди викликають імунний захист від природного токсину. Додатково, у патенті США № 6,610,300 описано вакцину на основі антигенного фрагмента мутантного бета-токсину С. perfringens. Проте, не залежно від того, чи одержана токсоїдна вакцина з природних організмів або рекомбінантним шляхом, вважається, що вона економічно витратна для одержання та введення токсоїдних протеїнів тваринам, що потребують імунізації, за винятком спеціальних умов (наприклад, лікування людей, що можуть мати алергію чи чутливість до інших компонентів вакцини для усього організму). Додатково, вакцини на основі протеїну/токсину типово потребують бустерної вакцинації для збереження повної ефективності. Інше запропоноване рішення полягало у конструюванні антигенно активного вірусу, що продукуватиме мутантний альфа-токсин, замість токсину дикого типу. Наприклад, Bennett et al. [Viral Immunol. 72(2):97-105 (1999)] продемонстрували рекомбінантний вірусний вектор коров'ячої віспи, що експресує нетоксичний С-домен альфа-токсину С. perfringens. На жаль, хоча протягом останніх 20 років було запропоновано декілька рекомбінантних вакцин коров'ячої віспи, все ще існує давня проблема щодо безпеки вивільнення живих інфекційних вірусів коров'ячої віспи в оточуюче середовище, де вони можуть потрапити людям, що не мають резистентності до цього вірусу. 1 UA 109105 C2 5 10 15 20 25 30 35 40 45 50 55 Відомо, що альфа-токсин (рlс ген) С. perfringens має декілька біологічних активностей, включаючи гемолітичну активність, фосфоліпазну С, сфінгомієліназну, фосфодіестеразну та летальну активності. З рівня техніки відомо ряд повідомлень стосовно мутацій до цих альфатоксинів, що знижують токсичність. Schoepe, et al. [Infect, and Immun. 69(11): 7194-7196 (2001)] описують штам С. perfringens, що зустрічається у природі, що продукує нетоксичний альфатоксин. Проте, може бути важко модифікувати цей штам для виклику імунного захисту від інших варіантних, але токсичних видів С. perfringens дикого типу. Williamson та Titball [Vaccine 11(12): 1253-1258 (1993)] показали, що регіон токсину від амінокислотних залишків 247 до 370 окремо є достатнім для імунізації мишей від газової гангрени, що була експериментально викликана С. perfringens. Alape-Giron ef al. [Eur. J. Biochem. 267:5191-5197 (2000)] повідомили, що заміщення у Asp269, Asp336, Tyr275, Tyr307, та Туr331 зменшували токсичність альфа-токсину. Nagahama, et al. [Infect, and Immun. 65:34893492 (1997)] повідомили, що заміщення Asp-56, Asp-130, або Glu-152 призвело до зменшення токсичності альфа-токсину. Nagahama et al. [J. Bacteriology 777:1179-1185 (1995)] повідомив, що заміщення гістидину у положенні 68 на нейтральну амінокислоту, таку, як гліцин, у альфатоксині С. perfringens призводило до повної втрати гемолітичної, фософліпазної С, сфінгомієліназної та летальної активності мутантного альфа-токсину. Ця одинарна амінокислотна зміна вважалася такою, що інактивує один з трьох цинк-зв'язуючих доменів протеїну. Цинк-зв'язуючий домен, інактивований шляхом заміщення His68, був пізніше позначений як Zn2 [Justin et al., Biochemistry 47:6253-6262 (2002)]. Незважаючи на викладене вище, у цій галузі все ще залишається потреба у безпечному, економному та ефективному способі захисту інтенсивно культивованих домашніх тварин, включаючи птахів, таких, як кури, від інфікування видами Clostridium, включаючи С. perfringens. Цитування будь-яких посилань у цій заявці не повинно трактуватися як визнання того, що таке посилання наявне як "рівень техніки" для цієї заявки. Стислий опис винаходу Для вирішення описаних вище проблем, що існують у цій галузі, даний винахід забезпечує молекули нуклеїнової кислоти, що кодують практично нетоксичний мутант альфа-токсину Clostridium perfringens. В одному такому втіленні, молекула нуклеїнової кислоти кодує мутантний альфа-токсин, що містить амінокислотну послідовність SEQ ID NO: 3, мінус щонайменше 18 послідовних амінокислотних залишків, де один з делетованих амінокислотних залишків являє собою His68. В іншому втіленні, молекула нуклеїнової кислоти кодує мутантний альфа-токсин, що містить амінокислотну послідовність SEQ ID NO: 3, мінус щонайменше 12 послідовних амінокислотних залишків, де один з делетованих амінокислотних залишків являє собою His68. В ще одному втіленні, молекула нуклеїнової кислоти кодує мутеїн, що містить амінокислотну послідовність SEQ ID NO: 3 мінус щонайменше 9 послідовних амінокислотних залишків, де один з делетованих амінокислотних залишків являє собою His68. В ще одному втіленні, молекула нуклеїнової кислоти кодує мутеїн, що містить амінокислотну послідовність SEQ ID NO: 3 мінус щонайменше 6 послідовних амінокислотних залишків, де один з делетованих амінокислотних залишків являє собою His68. В ще одному втіленні, молекула нуклеїнової кислоти кодує мутеїн, що містить амінокислотну послідовність SEQ ID NO: 3 мінус щонайменше 3 послідовних амінокислотних залишків, де один з делетованих амінокислотних залишків являє собою His68. В одному втіленні, молекула нуклеїнової кислоти за даним винаходом кодує мутеїн, в якому не більш ніж 48 послідовних амінокислотних залишків делетовані з амінокислотної послідовності SEQ ID NO: 3. В іншому втіленні, молекула нуклеїнової кислоти кодує мутеїн, в якому не більш ніж 36 послідовних амінокислотних залишків делетовані з амінокислотної послідовності SEQ ID NO: 3. В ще одному втіленні, молекула нуклеїнової кислоти кодує мутеїн, в якому не більш ніж 24 послідовних амінокислотних залишків делетовані з амінокислотної послідовності SEQ ID NO: 3. В ще одному втіленні, молекула нуклеїнової кислоти за даним винаходом кодує мутеїн, в якому не більш ніж 18 послідовних амінокислотних залишків делетовані з амінокислотної послідовності SEQ ID NO: 3. В конкретному втіленні, даний винахід забезпечує молекулу нуклеїнової кислоти, що кодує мутеїн, в якому дев'ять послідовних амінокислотних залишків делетовані з амінокислотної послідовності SEQ ID NO: 3, один з яких являє собою His68. В конкретному втіленні такого типу, молекула нуклеїнової кислоти кодує мутеїн, в якому делетовано дев'ять послідовних амінокислотних залишків у діапазоні від Туr62 до Trp70 SEQ ID NO: 3. В більш конкретному втіленні, молекула нуклеїнової кислоти кодує мутеїн, в якому ці делетовані дев'ять послідовних амінокислот заміщені одним лейциновим залишком. 2 UA 109105 C2 5 10 15 20 25 30 35 40 45 50 55 60 В іншому втіленні, молекула нуклеїнової кислоти містить нуклеотидну послідовність SEQ ID NO: 2, де нуклеотиди 268-294 делетовано. У конкретному втіленні такого типу, нуклеотиди 268294 нуклеотидної послідовності SEQ ID N0:2 заміщені трьома нуклеотидами, що кодують одинарний лейциновий залишок. Даний винахід також забезпечує практично нетоксичні мутанти альфа-токсину Clostridium perfringens. В одному такому втіленні, мутантний альфа-токсин містить амінокислотну послідовність SEQ ID NO: 3 мінус щонайменше 18 послідовних амінокислотних залишків, де один з делетованих амінокислотних залишків являє собою His68. В іншому втіленні, мутеїн містить амінокислотну послідовність SEQ ID NO: 3 мінус щонайменше 12 послідовних амінокислотних залишків, де один з делетованих амінокислотних залишків являє собою His68. B ще одному втіленні, мутеїн містить амінокислотну послідовність SEQ ID NO: 3 мінус щонайменше 9 послідовних амінокислотних залишків, де один з делетованих амінокислотних залишків являє собою His68. В ще одному втіленні, мутеїн містить амінокислотну послідовність SEQ ID NO: 3 мінус щонайменше 6 послідовних амінокислотних залишків, де один з делетованих амінокислотних залишків являє собою His68. В ще одному втіленні, мутеїн містить амінокислотну послідовність SEQ ID NO: 3 мінус щонайменше 3 послідовних амінокислотних залишків, де один з делетованих амінокислотних залишків являє собою His68. В одному втіленні, мутеїн за даним винаходом містить не більш ніж 48 послідовних амінокислотних залишків, видалених з амінокислотної послідовності SEQ ID NO: 3. В іншому втіленні, мутеїн містить не більш ніж 36 послідовних амінокислотних залишків, видалених з амінокислотної послідовності SEQ ID NO: 3. В ще одному втіленні, мутеїн містить не більш ніж 24 послідовних амінокислотних залишків, видалених з амінокислотної послідовності SEQ ID NO: 3. В ще одному втіленні мутеїн містить не більш ніж 18 послідовних амінокислотних залишків, видалених з амінокислотної послідовності SEQ ID NO: 3. У конкретному втіленні, даний винахід забезпечує практично нетоксичний мутеїн, де дев'ять послідовних амінокислотних залишків делетовано з амінокислотної послідовності SEQ ID NO: 3, один з яких являє собою His68. У більш конкретному втіленні даного типу, делетовано дев'ять послідовних амінокислотних залишків у діапазоні від Туr62 до Trp70 SEQ ID NO: 3. У ще більш конкретному втіленні, ці дев'ять видалених послідовних амінокислотних залишків заміщені одним лейциновим залишком в амінокислотній послідовності мутеїну. Даний винахід додатково забезпечує атенуйовані організми Clostridium perfringens, що мають молекулу нуклеїнової кислоти, яка кодує практично нетоксичний мутантний альфа-токсин Clostridium perfringens, інтегрований у хромосоми. Ця інтегрована молекула нуклеїнової кислоти, переважно, розташована у положенні на хромосомі, що є гомологічним положенню молекули нуклеїнової кислоти, що кодує альфа-токсин дикого типу у організмі Clostridium perfringens дикого типу. Таким чином, атенуйований організм Clostridium perfringens за даним винаходом може бути практично нетоксичним через відсутність функціонального гена рlс дикого типу. Як визначено у цій заявці, атенуйований Clostridium perfringens організм може бути Clostridium perfringens типу А. У конкретному втіленні даного винаходу, атенуйований організм Clostridium perfringens являє собою Clostridium perfringens CPERF/Δαтоксин 365-054 (Депозитний номер АТСС РТА7364). В іншому конкретному втіленні даного винаходу, атенуйований Clostridium perfringens організм являє собою Clostridium perfringens CPERF/Δαтоксин 365-053 (Депозитний номер АТСС РТА7365). Організм Clostridium perfringens, атенуйований способами за даним винаходом, може бути виділений з тварини-хазяїна, що є ссавцем чи птахом. Такі тварини можуть включати: корів, овець та свиней. Приклади придатних птахів включають курей, індиків, качок, голубів, гусей, диких голубів, лебедів, куріпок та шотландських куріпок. Даний винахід також забезпечує вакцини. Такі вакцини можуть містити атенуйовані організми Clostridium perfringens за даним винаходом. Вакцини за даним винаходом можуть також включати фармакологічно придатні буфери, ексципієнти та/або ад'юванти. Додатково, даний винахід забезпечує способи розвитку імунітету до Clostridium perfringens у тварини. Одне таке втілення включає введення імунологічно ефективної дози вакцини за даним винаходом тварині. Вакцини за даним винаходом можуть бути введені різними маршрутами, включаючи: пероральний, внутрішньом'язовий, внутрішньовенний, інтрадермальний, підшкірний та інтраназальний. Вакцина за даним винаходом може бути додана у корм тварини та/або розпилена на тварин для забезпечення перорального введення. Даний винахід додатково забезпечує корм для тварин, що містить вакцину за даним винаходом. Даний винахід також забезпечує атенуйований організм Clostridium perfringens за даним винаходом, що додатково експресує щонайменше один ген, що кодує не-Clostridium perfringens 3 UA 109105 C2 5 10 15 20 25 30 35 40 45 50 55 поліпептид. В одному такому втіленні, один чи більше не-Clostridium perfringens поліпептидів є бактеріальними поліпептидами, такими, як антигенні протеїни Е. соlі, сальмонеаа, lawsonia, або кампілобактер та ін., та/або їх комбінації. Альтернативно, або у комбінації із зазначеним вище, не-Clostridium perfringens поліпептид може бути небактеріальним поліпептидом. Приклади таких небактеріальних поліпептидів включають протеїни ссавців чи птахів, наприклад, цитокіни, такі, як IL-18 курей; такі віруси, як ротавірус чи коронавірус; та такі паразити, як еймерія, ізоспора, та криптоспорідій. В іншому аспекті, даний винахід забезпечує антитіло, що селективно зв'язує епітоп, відсутній у практично нетоксичному мутантному альфа-токсині Clostridium perfringens. Такі антитіла можуть розрізняти практично нетоксичні мутеїни від Clostridium perfringens альфа-токсинів дикого типу. Також забезпечуються тестові набори, що включають антитіла за даним винаходом для використання при ідентифікації того, чи була вакцинована тварина-об'єкт, або альтернативно, була природно інфікована організмом Clostridium perfringens. Відповідно, також забезпечуються способи ідентифікації та/або розпізнавання тварини, що була природно інфікована організмом Clostridium perfringens одного вакцинованого атенуйованим організмом Clostridium perfringens. В одному такому втіленні, спосіб включає контактування рідкої проби, взятої у тварини, з антитілом, що селективно зв'язує епітоп, знайдений у Clostridium perfringens альфа-токсині дикого типу, що був делегований з практично нетоксичного мутеїну альфа-токсину Clostridium perfringens за даним винаходом. Тому, антитіло може розрізняти тих тварин, що були вакциновані практично нетоксичним мутантом альфатоксину Clostridium perfringens за даним винаходом (та/або атенуйованим організмом Clostridium perfringens, що експресує мутеїн), від інфікованих чи таких, що були інфіковані Clostridium perfringens альфа-токсином дикого типу. Наступною стадією є визначення того, чи реагує антитіло із пробою рідини, наприклад, зв'язує антиген, що міститься у пробі. Тварину ідентифікують як таку, що є/була природно інфікована організмом Clostridium perfringens, коли антитіло реагує з пробою рідини. На Фіг. 1 проілюстровано геномне картування регіону, що кодує С. perfringens альфа-токсин. Показано положення двох великих (1182 основні пари та 1746 основні пари) фрагментів, відповідно, що використовували для конструювання CPERF001. Також показано положення утвореної делеції 27 основної пари. "Yрlс" означає ген yрlс (СРЕ0035); "рlс" означає ген, що кодує альфа-токсин (фосфоліпазу С), a "CobW" означає нижній ген. На Фіг. 2А проілюстровано послідовність частини гена рlс від С. perfringens штаму СР6 [SEQ ID NO: 4; це частина SEQ ID NO: 22, (тобто, нуклеотиди 262-300) фрагмента рlс гена від СР6] та відповідну пептидну послідовність (SEQ ID NO: 5), де підкреслено сайт рестрикції ВаmН1 ендонуклеази, використаний для створення делеції. На Фіг. 2В проілюстровано послідовність праймеру (SEQ ID NO: 6), використаного для створення делеції у батьківському С. perfringens штамі 1240, з утворенням делетованого CPERF001. Підкреслено сайт рестрикції BamH1, включений у праймер для сприяння конструюванню делеції. Також проілюстровано відповідний пептид (SEQ ID NO: 7). На Фіг. 2С проілюстровано послідовність делеції, утвореної у CPERF001 (SEQ ID NO: 8; нуклеотиди 103-117) та у відповідному пептиді (SEQ ID NO: 9). Підкреслено збережений ендонуклеазний сайт рестрикції ВаmН1. Фіг. 3А знов проілюстровано послідовність частини гена рlс від С. perfringens штаму СР6 [SEQ ID NO: 4, нуклеотиди 262-300] та відповідної пептидної послідовності (SEQ ID NO: 5), де підкреслено ендонуклеазний сайт рестрикції ВаmН1, використаний для створення делеції. На Фіг. 3В проілюстровано послідовність праймеру (SEQ ID NО:10), використаного для створення делеції у батьківському С. perfringens штамі 29, з утворенням делетованого CPERF002. Також проілюстровано відповідний пептид (SEQ ID NО:11). На Фіг. 3С проілюстровано послідовність делеції, утвореної у CPERF002 (SEQ ID NO: 12) та відповідного пептиду (SEQ ID NO: 13). Детальний опис винаходу Відповідно, даний винахід забезпечує модифіковані організми та культури Clostridia, що експресують один чи більше токсинів Clostridia, наприклад, альфа-токсини, як мутеїни, що не мають визначеної токсичності, та/або практично низьку токсичність, по відношенню до природних токсинів та токсинів Clostridia дикого типу. Переважно, мутантні організми С. perfringens за даним винаходом легко вводять тваринам як живі вакцини, також забезпечуються мутантні альфа-токсини С. perfringens. Також уданому винаході забезпечуються, разом із 4 UA 109105 C2 5 10 15 20 25 30 35 40 45 50 55 60 молекулами нуклеїнових кислот, що кодують мутеїни, вектори експресії альфа-токсинів, та способи їх використання. Для забезпечення зрозумілого опису винаходу, декілька термінів визначено наступним чином. Вакцина являє собою композицію, що включає імуноген, та інші фармацевтично прийнятні інгредієнти, включаючи, у деяких втіленнях, придатні ад'юванти. Як вживається у цій заявці, термін "імуноген" описує композицію, речовину чи вектор, що при введенні у тварину стимулює імунний відклик. Для цілей даного винаходу, імуноген вважають таким, що включає будь-який вектор, здатний до експресії чи введення мутантного альфа-токсину за даним винаходом у тварину, що має бути імунізована. Вектор включає, наприклад, С. perfringens за даним винаходом чи інші придатні мікроорганізми, що експресують мутантний альфа-токсин за даним винаходом при введенні вектора у тварину. Вектор також включає відомі з рівня техніки молекули нуклеїнової кислоти, наприклад, плазміди та ін., що експресують мутантний альфатоксин за даним винаходом при безпосередньому введенні у тварину, наприклад, шляхом введення клітини тварини та експресії мутантного альфа-токсину тварині. Імуноген є також протеїном, таким, як альфа-токсин за даним винаходом, задіяний окремо або як частина придатної вакцинної композиції. Як вживається у цій заявці, та якщо не вказано інше, терміни "імунізувати" та "вакцинувати" є синонімами та їх використовують взаємозамінно для опису введення імуногену у тварину для виклику імунної відповіді у тварини. Викликаний імунний відклик забезпечує захисний імунітет тварині, яку лікують, що обмежує чи зменшує клінічні ознаки хвороби, наприклад, газової гангрени, та/або смертності, у вакцинованих тварин, що пізніше вводять з вірулентною дозою видів С. perfringens, для яких вакцина за даним винаходом є захисною. Термін "ад'ювант" визначають як одну чи більше речовин, що викликають стимуляцію імунної систему. У цьому контексті, ад'ювант використовують для підвищення імунного відклику на одну чи більше антигенів/ізолятів вакцини. Ад'ювант може бути введений тварині-мішені перед, у комбінації з, або після введення вакцини. Ад'юванти за даним винаходом можна одержати з будь-яких джерел, включаючи природні джерела, рекомбінантні джерела та/або хімічний синтез та ін. Приклади хімічних сполук, використаних як ад'юванти включають, але не обмежуються наведеним, сполуки алюмінію; олії, здатні та не здатні до метаболізму; блоккополімери; ISCOM (імуностимулюючі комплекси); вітаміни та мінерали (включаючи, але не обмежуючись наведеним: вітамін Е, вітамін А, селен та вітамін В12); Quil А (сапоніни); перехресно-зшиті акрилові кислотні полімери {наприклад, полімери проп-2-єнової кислоти) перехресно-зшиті на різних рівнях з поліалкенільним поліефром, що продають під торгівельною маркою CARBOPOL®; та/або однорідно розпилені мікронні краплі емульсії олії у воді, наприклад, що продають під торгівельною маркою Emulsigen®. Додаткові приклади ад'ювантів, що іноді мають назву імуностимуляторів, включають включають бактеріальні та грибкові компоненти клітинних стінок (наприклад, ліпополісахариди, ліпопротеїни, глюкопротеїни, мурамілпептиди, бета-1,3/1,6-глюкани), різні комплексні вуглеводні, одержані з рослин [наприклад, глікани, ацеманнан), різні протеїни та пептиди, одержані з тварин (наприклад, гормони, цитокіни, костимулюючі фактори), та нові нуклеїнові кислоти, одержані з вірусів та інших джерел (наприклад, подвійно-ланцюгового РНК, CpG). Додатково, ефект ад'ювантів може забезпечити будь-яка кількість комбінацій вищевказанихречовин, і тому може утворити ад'ювант за даним винаходом. Термін "антитіло", як вживається у цій заявці, призначено для охоплення поліклональних антитіл, моноклональних антитіл та/або їх фрагментів чи рекомбінантних похідних, включаючи сконструйовані зв'язуючі протеїни, що включають варіабельні домени антитіл. Як вживається у цій заявці, нумерація залишків та положення амінокислотних залишків протеїнів альфа-токсину за даним винаходом засновано на системі нумерації, описаній для Closthdium perfringens штаму 13. Штам 13 альфа-токсину С. perfringens повідомлений під номером доступу GenBank № NC 003366, та проілюстрований SEQ ID NO: 1. Весь протеїн має довжину у 398 амінокислот. Альфа-токсин, кодований мутантними векторами, показаними у цій заявці нижче, відповідає протеїну SEQ ID NO: 1, що має делецію амінокислотних залишків 9098. Це 28 амінокислотна сигнальна послідовність, розщеплена протягом дозрівання протеїну. Тому ілюстративна делеція відповідає амінокислотним залишкам 62-70 зрілого протеїна, довжиною у 370 амінокислот (SEQ ID NO: 3). Нумерація кодонів ДНК, що кодує протеїни альфа-токсину за даним винаходом, заснована на штамі 13 гена рlс Clostridium perfringens, що повідомлений під номером доступу GenBank № NP 560952, та проілюстрований SEQ ID NO: 2. Кодуюча послідовність альфа-токсину розпочинається від нуклеотиду 48590 до 49786 у С. perfringens штамі 13. Делеція кодонів у двох конструктах, проілюстрованих у цій заявці, відповідає нулеотидам 48857 до (та включаючи 5 UA 109105 C2 5 10 15 20 25 30 35 40 45 50 55 60 48883 NP 560952 ген. Ця делеція знайдена у гені альфа-токсину та відповідає нуклеотидам 268294 у кодуючій послідовності SEQ ID NO: 2. Додатково, використання термінів в однині для зручності в описі жодним чином не призначено для такого обмеження. Тому, наприклад, посилання на композицію, що містить С. perfringens клітину, включає посилання на одну чи більше таких клітин. Також має бути зрозумілим, що даний винахід не обмежений конкретними конфігураціями, стадіями процесу та матеріалами, описаними у цій заявці, оскільки такі конфігурації, стадії процесу та матеріали можуть дещо варіюватися. Також має бути зрозумілим, що термінологія, що вживається у цій заявці, використана лише для опису конкретних втілень та не призначена для обмеження, оскільки обсяг даного винаходу буде обмежений лише формулою, що додається, та її еквівалентами. У конкретному втіленні даного винаходу, забезпечуються незворотні мутанти С. perfringens, що є "практично нетоксичними, " тобто, організмами, що обмежено експресують імуногенні альфа-токсини, та нетоксичні, що надає ним, таким чином, придатності для використання як захисних вакцин. Тому організми С. perfringens за даним винаходом мають достатньо знижену токсичність, відносно організмів С. perfringens дикого типу, що надає ним переносності як вакцини чи антигену при застосуванні за умов, ефективних для виклику анти-альфа-токсинного чи aнти-C-perfringens імунного відклику у всіх тварин, вакцинованих таким чином. Тому, організм С. perfringens за даним винаходом є "атенуйованим" відносно С. perfringens дикого типу… Фраза "практично нетоксичний" також призначена для застосування до вищезазначених імуногенних і альфа-токсичних мутеїнів, що мають достатньо низьку або відсутню токсичність, що також робить їх придатними для використання як захисні вакцини. Зниження токсичності вимірюють, наприклад, за допомогою одного з наступних тестів, відомих з рівня техніки: гемолітичної активності, фосфоліпазної С активності, сфінгомієліназної активності, фосфодіестеразної активності, та загальної летальної активності у тестовій групі тварин. Загалом, за такими стандартними тестами не було знайдено остаточної токсичності. Тим не менш, наявність мінімального рівня однієї чи більше таких активностей, наприклад, від, -4 -2 приблизно, 10 , до, приблизно, 10 , відносно токсичності еквівалентної кількості інфекційних одиниць альфа-токсину С. perfringens дикого типу, з якого було одержано мутеїн, як доведено, може бути прийнятною для застосування у ветеринарії. В одному втіленні, винахід реалізують на практиці шляхом застосування штамів біотипу А С. perfringens, що є особливо важливими як етіологічні агенти різних типів гангрени та кишкових хвороб. Зокрема, альфа-токсин С. perfringens є мішенню делеції-атенуації, оскільки атенуація цього токсину є достатньою для того, щоб вважати С. perfringens у достатньому ступнею нелетальним, порівняно із штамами дикого типу. Загалом, С. perfringens рlс ген за даним винаходом експресує мутантний альфа-токсин. Мутантний альфа-токсин має делецію, що включає His Zn2 петлі, разом із бічними залишками, для більшого зниження можливості будь-якої зворотної мутації у токсичну форму. Було знайдено, що делеція Zn2 петлі His залишку, наприклад, His6e SEQ ID NO: 3, разом із делецією додаткових залишків, що оточують залишок His петлі Zn2, забезпечує альфа-токсин, що зберігає достатню імуногенність для виклику захисного імунітету у тварин, вакцинованих С. perfringens за даним винаходом, та також, ймовірність проходження зворотної мутації для кодування альфа-токсину дикого типу, є низькою. Додаткові залишки можуть бути делетовані у С-кінцевому напрямі та/або у N-кінцевому напрямі, по відношенню до His68, та можуть знаходитися у діапазоні від, приблизно, 4 до, приблизно, 60 залишків у будь-якому такому напрямку. Альтернативно, His148 та бічні залишки можуть бути делетовані аналогічно. Одне з втілень даного винаходу також включає мутантний альфа-токсин, додатково до делеції HiS68, делеції щонайменше 30 амінокислотних залишків з будь-якого боку (у С-кінцевому чи N-кінцевому напрямку) His68 положення, відносно SEQ ID NO: 3. В іншому втіленні даного винаходу мутантний альфа-токсин включає, додатково до делеції of His68, делецію щонайменше 20 амінокислотних залишків з будь-якого боку His6e, відносно SEQ ID NO: 3. В ще одному альтернативному втіленні даного винаходу мутантний альфа-токсин включає, додатково до делеції His68, делецію щонайменше 5 амінокислотних залишків з будь-якого боку His68, відносно SEQ ID NO: 3. В ще одному втіленні даного винаходу мутантний альфа-токсин включає делецію від, приблизно, залишку 62 до, приблизно, залишку 70, відносно SEQ ID NO: 3. Необов'язково, делетовані амінокислотні залишки заміщені одним чи більше іншими залишками, такими, як одинарний лейциновий залишок. У ще одному додатковому втіленні, мутантний альфа-токсин С. perfringens, продукований та виділений з С. perfringens, або альтернативного рекомбінантного організму, для застосування як реагент для дослідження та/або у діагностичному наборі чи аналізах, наприклад, як мішень 6 UA 109105 C2 5 10 15 20 25 30 35 40 45 50 55 для анти-альфа-токсинових антитіл. Ще одним використанням мутантних альфа-токсинових С. perfringens протеїнів є спеціалізовані вакцини для тварин, наприклад, людей, що не можуть переносити вакцинацію атенуйованим С. perfringens організмом за даним винаходом. Додатково, даний винахід забезпечує антитіло, що специфічно зв'язує альфа-токсин дикого типу відносно мутантних альфа-токсинів за даним винаходом. У додатковому втіленні, забезпечується антитіло, що переважно зв'язує альфа-токсиновий С. perfringens протеїн дикого типу, проявляючи мінімальне чи відсутність зв'язування із мутантним альфа-токсином за даним винаходом, наприклад, уникаючи зв'язування альфатоксичного мутеїну, що має делецію, що детально описана, supra. Забезпечується антитіло, що, через це, є корисним для розпізнавання делеції мутантного альфа-токсину від альфа-токсину дикого типу, та тому, також, корисним для розпізнавання тварин, вакцинованих вакциною за даним винаходом, одержаною від тварин, що були інфіковані С. perfringens дикого типу. Способи виклику та скринінгу таких селективних антитіл відомі з рівня техніки. Аналогічно, також одержують антитіла за даним винаходом, що розпізнають мутантний альфа-токсин за даним винаходом, але не протеїн дикого типу. Антитіла за даним винаходом можуть бути поліклональними, моноклональними ("mAb") чи фрагментами чи сконструйованими фрагментами чи похідними таких антитіл, що зберігають селективні зв'язуючі властивості. Методи одержання та скринінгу моноклональних антитіл були детально описані [див., наприклад, Stites, et at. (eds.) Basic and Clinical Immunology (4th ed.), Lange Medical Publications, Los Altos, California (1988); Harlow and Lane, Aнтиbodies: A Laboratory Manual, CSH Press (1988); Goding, Monoclonal Aнтиbodies: Principles and Practice (26 ed.), Academic Press, New York (1986); та Kohler and Milstein, Nature 256:495-497 (1975), усі з яких включені до цієї заявки шляхом посилання]. Наприклад, та без обмежень, імунний відклик викликають у придатних тварин, таких, як миші чи кури, шляхом вакцинації очищеним альфа-протеїном С. perfringens дикого типу, наприклад, у комбінації з придатним ад'ювантом. Наприклад, для уникнення токсичності альфа протеїну дикого типу, імуноген є пептидом, що відповідає делетованим залишкам, та, якщо потрібно, імуногенність пептиду підвищують шляхом комбінування із придатним ад'ювантом або шляхом сполучення із придатним протеїном-носієм. Сполучення із придатним протеїном-носієм відомо з рівня техніки, та може бути здійснено, наприклад, шляхом забезпечення пептиду з термінальним цистеїном, та його сполучення із гемоціанин фісурелла (KLH) чи альбуміну бичачої сироватки (BSA) з використанням хімії малеїмідного сполучення чи сульфосукциніміділ-4-[N малеїмідометил]циклогексан-1карбоксилатного) лінкера (від Pierce). Також можу бути використаний карбодіімідний лінкер, що не потребує термінального цистеїну. Для одержання моноклональних антитіл, лімфоцити селезінки можуть бути одержані з імунізованої тварини, гібридоми одержують з цих лімфоцитів, та може бути одержаний один чи більше потенційно придатні гібридом, що експресують анти-альфа протеїн. Гібридоми піддають скринінгу щодо мутантних та дикого типу альфа-протеїнів, а гібридому, що експресує антитіло, що зв'язує лише альфа-токсин дикого типу, ідентифікують, клонують та застосовують для продукування моноклональних антитіл, що зв'язують лише альфа протеїн дикого типу. Необов'язково, одержують кДНК ідентифікованої гібридомної клітинної лінії, а рекомбінантні антитіла чи фрагменти антитіл можуть бути одержані в інших системах експресії, відомих з рівня техніки. Як обговорено вище, одним з можливих недоліків вакцинації, взагалі, є те, що тварини після вакцинації можуть давати фальшивий позитивний результат при проведенні тестів на інфекцію з використанням антитіл, що виникають у штамі, що зустрічається у природі, таким чином, перешкоджаючи ідентифікації інфікованої тварини. Тому даний винахід забезпечує тестовий набір для розрізнення об'єктної тварини, що була природним організмом С. perfringens, від тварини, вакцинованої мутантним альфа-токсином за даним винаходом. Один такий тестовий набір включає ряд селективних анти-дикого-типу альфа-токсинових антитіл, що проявляє мінімальне чи відсутнє зв'язування із мутантним альфа-токсином за даним винаходом. Набір також включає інші придатні реагенти, достатні для проведення щонайменше одного діагностичного тесту. У додатковому втіленні, антитіло мічене легко визначаємою групою, наприклад, будь-яким відомим з рівня техніки ферментним маркером, наприклад, пероксидазою; флуоресцентною міткою, наприклад, флуоресцеїном; носіями, включаючи магнітні носії; та ін. Необов'язково, набір може додатково включати мічене антитіло, що селективно зв'язує селективне анти-дикого типу альфа-токсинове антитіло. Імуноферментні добре відомі у цій галузі, та включають імуноферментний сендвічевий аналіз, конкурентні 7 UA 109105 C2 5 10 15 20 25 30 35 40 45 50 55 60 імуноферментні аналізи, твердофазний імуноферментний аналіз (ELISA), радіоактивні імуноферментні аналізи (RIA) та інші. Також забезпечуються способи ідентифікації та розрізнення тварини, що була інфікована природним організмом С. perfringens, тобто, дикого типу, від тварини, вакцинованої вакциною, що містить атенуйований С. perfringens організм за даним винаходом, що здійснюють, наприклад, у наступі стадії: (a) контактування проби рідини, взятої у тварини, з вищеописаним селективним анти-дикого типу альфа-токсиновим антитілом, що проявляє мінімальне чи відсутнє зв'язування із мутантним альфа-токсином за даним винаходом; та (b) визначення того, чи реагує антитіло з пробою рідини; де, коли антитіло реагує з пробою рідини, тварину ідентифікують як таку, що була інфікована природним організмом С. perfringens організм. Продукування атенуйованих штамів С. Perfrinaens Процес перетворення ізоляту С. perfringens дикого типу на атенуйований, чи практично нетоксичний, штам, придатний для введення як вакцина, може бути проведений таким чином. Ген альфа-токсину (рlс) може бути заміщений у бактеріальній хромосомі на ген, що кодує лише альфа-токсиновий мутеїн, без збереження здатності m С. perfringens організму продукувати альфа-токсин дикого типу. Дуже широко, процес продукування вакцини організму включає, не обмежуючись наведеним, наступні загальні стадії, не обов'язково у вказаному порядку. (1) ідентифікація виду тварини, що має бути захищена шляхом вакцинації, та одного чи більше клінічних ізолятів, одержаних для процедур скринінгу. Ця стадія є, типово, необов'язковою, у випадку альфа-токсину, оскільки ізоляти одного виду тварин, більш ймовірно, забезпечують захист іншому виду тварин. (2) ампліфікація гена рlс з ізоляту чи ізолятів С. perfringens, наприклад, за допомогою ПЦР чи іншої відомої у цій галузі технології ампліфікації нуклеїнових кислот, з придатними фланкуючими праймерами, та застосування ампліфікації придатними праймерами для створення бажаної мутації делеції. Альтернативно, може бути вивчена відповідна бібліотека. (3) створення суїцидного вектора, що містить ген делеції рlс, в якому джерело реплікації С. perfringens видалено, та/або джерело реплікації, що може реплікувати С. perfringens просто відсутнє; та в іншому випадку, включає придатні селективні маркери, наприклад, антибіотичні маркери, прилеглі до мутованого гена рlс. Такий вектор може бути потім введений у С. perfringens організми, наприклад, шляхом електропорації, чи іншими способами, відомими з рівня техніки. (4) відбір С. perfringens організмів, в яких мутантний ген рlс був успішно інтегрований у бактеріальний хромосом. Це здійснюють шляхом культивування С. perfringens організмів стадії (3) у присутності селектовного агента, наприклад, антибіотика(ів), що відповідають селективним маркерам. Наприклад, єдині С. perfringens організми, що можуть зростати під селекцією антибіотиків, можуть бути організмами, що шляхом гомологічної рекомбінації можуть бути безпосередньо інтегровані у суїцидний вектор, з його геном(ми) резистентності до антибіотиків, у бактеріальну хромосому. Ці зростаючі С. perfringens організми тому, матимуть два прилеглі гени рlс, один дикого типу, тоді як інший може мати мутацію делеції. (5) відбір С. perfringens організмів, в яких відбулася додаткова рекомбінація, з видаленням селектовних маркерів, наприклад, антибіотичних маркерів, разом із геном рlс дикого типу. Це здійснюють шляхом культивування організмів (4) у відсутність селектовного агента, наприклад, антибіотика, та відбору не-гемолітичних клонів на агару крові. Оскільки інсерцію мутантної нуклеїнової кислоти здійснюють шляхом гомологічної рекомбінації, молекулу нуклеїнової кислоти, що кодує мутантний альфа-токсин, вводять у хромосомне положення, що гомологічне положенню молекули нуклеїнової кислоти, що кодує альфа-токсин дикого типу, присутній у неатенуйованому Clostridium perfringens. Більш детально, польові ізоляти С. perfringens одержують від хворих тварин чи інших джерел. Спочатку, геномні ДНК, що одержують з польових ізолятів, що розглядають, водять у придатний дуальний шаттл-вектор мікроорганізму, наприклад, шаттл-плазміда, із селектовними маркерами, наприклад, антибіотичними маркерами, для оцінки здатності до трансформації. Загалом, приданий шаттл-вектор включатиме одну, дві, три чи більше наступних ознак, сайт клонування, джерело реплікації С. perfringens, джерело реплікації Е. соlі, та ген резистентності до антибіотиків та/або селектовний маркер. Вектори, відомі з рівня техніки, придатні для цього, чи легко адаптовані для цього, включають, наприклад, рекомбінантна шаттл-плазміда pHR106, описана Roberts et al., [Appl Env Mircobiol 54: 268-270 (1988)]; pJIR 750 та pJIR 751 плазміди, описані Bannam, et al., [Plasmid 29:233-235 (1993)]; pPSV промоторний вектор селекції без промотору Matsushita, et al., 1994, Plasmid 31, 317-319; шаттл-плазміди pJIR1456 and pJIR1457, 8 UA 109105 C2 5 10 15 20 25 30 35 40 45 50 55 60 описані Lyras, et al., 1988, Plasmid 39, 160-164; та рАK201 шаттл-вектор, описаний Kim ef al., 1989, Appl Environ Microbiol 55, 360-365, зміст яких повністю включений до цієї заявки шляхом посилання. Видалення джерела реплікації С. perfringens перетворює шаттл-вектор на суїцидний вектор. Наприклад, однією з шаттл-плазмід є pJIR418, описана Sloan, et al., 1992, Plasmid 27, 207219, включена до цієї заявки шляхом посилання. 4 Ізоляти, що призводять до утворення 10 трансформантів на мікрограм плазмідного ДНК, чутливі до антибіотичного маркеру, наприклад, .хлорамфенікол чи еритроміцин, є можливими кандидатами для делеції. Геномні ДК кандидатних штамів потім використовують як темплату для довгого ПЦР гена рlс (альфа-токсину) та фланкуючих послідовностей кандидатних штамів. Наприклад, як проілюстровано у цій заявці нижче, штам С. perfringens 13 хромосоми використовували для ідентифікації праймерів для ампліфікації гена, що кодує альфа-токсин. Ці праймери потім використовували для клонування гена альфа-токсину з іншого штаму, що був пташиним ізолятом СР6. Після субклонування продуктів ПЦР, ген альфа-токсину та фланкуючі регіони секвенують та рестрикційно картують. З фланкуючих сайтів рестрикції синтезують нові олігонуклеотидні праймери, а продукти двох окремих ампліфікацій клонують у придатну суїцидну плазміду (джерело реплікації С. perfringens видалено), наприклад, показану нижче у цій заявці як плазміда 1192-23.1 для створення бажаного штаму вакцини з делецією. Забезпечений суїцидний вектор(и), специфічні до ізоляту(ів) вводять у відповідний тваринний штам С. perfringens, за допомогою будь-якого стандартного способу, відомого з рівня техніки. Наприклад, це здійснюють шляхом електропорації. Коли суїцидний вектор вводять у С. perfringens (без джерела реплікації С. perfringens, відсутня можливість реплікувати у цитоплазму, та не виживає, якщо не інтегрується у бактеріальний хромосом.) Успішні інтегранти являють собою лише такі організми, що зростатимуть у присутності антибіотика, що відповідає заново введеному антибіотичному маркерному гена. Може бути застосований будь-який відомий з рівня техніки селектовний маркерний ген, хоча у векторах, наведених у цій заявці нижче, використані маркери хорамфеніколу та/або еритроміцину. Ці рекомбінантні явища призводять з гомології гена рlс дикого типу до делеції генного рlс плазміди ДНК. Результуючі рекомбінантні бактерії мають інтегрантів. Інтегрант містить копію введеного вектора гомології, інтегрованого у локус гена рlс. Тому утворений у результаті інтегрант включає дві копії гена рlс, оригінальну нормальну копію та введену делетовану версію. Введені гени резистентності до антибіотиків розташовані між двома копіями гена рlс. Можуть відбуватися рідкі випадкові рекомбінації між двома копіями гена рlс. Така рекомбінація може призвести до одного з двох результатів. В обох випадках, ДНК, що розташовано між двома копіями гена рlс (включаючи гени резистентності), видалено. У першому випадку, зберігається нормальний чи дикого типу ген рlс, що призводить до відновлення оригінального батьківського штаму без антибіотичних маркерів. У другому випадку, ген рlс дикого типу заміщують делетованою копією, з утворенням бажаного делетованого конструкту альфа-токсину, без антибіотичних маркерів. Видалення антибіотиків з культурального середовища дозволяє цим бактеріям, в яких відбулася рекомбінація, виживати та реплікувати. Рекомбінантні клони делеції потім ідентифікують за зростанням на кров'яному агарі, без гемолізу, що нормально проявляє С. рerfringens, що експресує альфа-токсин дикого типу. Тварини, що мають одержати вакцинацію Тварини, для яких може бути продукована атенуйована вакцина С. perfhngens, та з яких може бути ізольований корисний штам С. perfringens дикого типу, включають, загалом, будьяких тварин, для яких інфекція С. perfringens є проблемою. Хребетні, що розглядаються, включають птахів, ссавців, та риб, та особливо тварин, важливих з економічної та/або сільськогосподарської точки зору. У наступному списку тварин наведено ті з них, що мають переваги від вакцинації С. perfringens та/або для яких можуть бути одержані корисні ізоляти С. perfringens дикого типу. Іноді можливо, щоб будь-яка така вакцина містила компонент (живий чи неживий), що був спочатку виділений з того ж самого роду чи виду тварини, що має бути вакцинована, але це не обов'язково. Необмежуючий список таких тварин включає такі сімейства птахів, корів, овець та ін., а також водних тварин, наприклад, що можуть бути піддані аквакультивуванню та/або зібрані з диких тварин та зберігатися живими у резервуарах для зберігання до збуту на ринку. Вони включають таких риб, як форель чи лосось, та інші види, що розводять чи збирають для одержання економічної вигоди. Безхребетні водні тварини включають лобстерів, крабів, 9 UA 109105 C2 5 10 молюсків, наприклад кальмара, восьминога, молюска, устрицю, гребінця та ін. Птахи мають бути розглянуті як такі, що включають, наприклад, курей, індиків, гусей, качок, та ін. Корови мають бути розглянуті як такі, що включають, наприклад, корів, биків, телят, та ін. Вівці мають бути розглянуті як такі, що включають, наприклад, ягнят та ін. Для цілей даного винаходу, термін "риба" має тлумачитися як такий, що включає, без обмежень, групу риб Teleosti, тобто, телеостів. Як ряд Salmoniformes (що включає лососеві сімейства), так і ряд Perciformesr (що включає Центрархові сімейства), включені до групи Teleosti. Приклади можливих риб-реципієнтів включають лососеві сімейства, серранові сімейства, сімейства Sparidae, сімейства Цихліди, сімейства Центрархові, простіпому (Parapristipoma trilineatum), та плекостомус блакитноокий (Plecostomus spp). Сімейство Лососеві НАЗВА ТАКСОНУ Coregonus clupeaformis Coregonus hoyi Oncorhynchus keta Oncorhynchus gorbuscha Oncorhynchus kisutch Oncorhynchus masou Oncorhynchus nerka Oncorhynchus tshawytscha Prosopium cylindraceum Oncorhynchus clarki Oncorhynchus mykiss Salmo salar Salmo trutta Salmo trutta X S. fontinalis Salvelinus alpinus Salvelinus confluentus Salvelinus fontinalis Salvelinus leucomaenis Salvelinus malma Salvelinus namaycush Thymallus thymallus НАЗВА ТАКСОНУ Centropristis ocyurus Centropristis philadelphicus Centropristis striata Diplectrum bivittatum Diplectrum formosum Epinephelus flavolimbatus Epinephelus morio Serranus phoebe Serranus tortuqarum Деякі члени сімейства Sparidae НАЗВА ТАКСОНУ Archosaraus probatocephalus Archosarqus rhomboidalis Calamus penna Laqodon rhomboides Pagrus Major Sparus aurata Stenotomus chrysops Деякі члени сімейства Цихліди НАЗВА ТАКСОНУ Aequidens latifrons ЗАГАЛЬНА НАЗВА Оселедцеподібний сиг Оселедець Кета Горбуша Кижуч (сріблястий лосось) Сима (сима-мазу) Нерка (чавича) Валек Лосось Кларка Райдужна форель Атлантичний лосось Озерна форель Морська форель Арктичний голець Великоголовий голець Американська палія Кунджа Мальма (тихоокеанський голець) Озерний голець-кристівомер Харіус Деякі члени сімейства Серранові ЗАГАЛЬНА НАЗВА Береговий сібас Кам'яний сібас Чорний сібас Карліковий піщаний окунь Піщаний окунь Жовтокаймлений кам'яний окунь Червоний групер Пліткар Кам'яний карликовий окунь ЗАГАЛЬНА НАЗВА Кейпкодський карась Морський лящ Центральноамериканський карась Кагалона Червоний тай Морський карась Скап ЗАГАЛЬНА НАЗВА Вродливий пельматохроміс 10 UA 109105 C2 Конго цихліда Щука цихліда Риба янгол Мозамбікська риба, що виношує молодь у роті Тиляпія Золотиста тиляпія Деякі члени сімейства Центрархові НАЗВА ТАКСОНУ ЗАГАЛЬНА НАЗВА Ambloplites rupestris Кам'яний окунь Centrarchus macropterus Вухастий окунь Elassoma evergladei Болотиста карликова сонячна риба Elassoma okefenokee Карликова сонячна риба окефенокі Elassoma zonatum Смугаста карликова сонячна риба Enneacanthus gloriosus Блакитна плямиста сонячна риба Enneacanthus obesus Смугаста сонячна риба Lepomis auritus Малинова сонячна риба Leoomis cyanellus Зелена сонячна риба Lepomis cyanellus X L. qibbosus Зелена х звичайна сонячна риба Lepomis qibbosus Звичайна сонячна риба Lepomis gulosus Сонячний окунь Lepomis humilis Жовтогарячо-плямиста сонячна риба Lepomis macrochirus Блакитнозяброва сонячна риба Lepomis meqalotis Рожева сонячна риба Micropterus coosae Мілководний окунь Micropterus dolomieui Малоротий окунь Micropterus punctulatus Плямистий окунь Micropterus salmoides Великоротий чорний окунь Pomoxis annularis Білий краппі Pomoxis nigromaculatus Чорний краппі Cichlisoma niprofasciatum Crenichichla sp. Pterophyllum scalare Tilapia mossambica Oreochromis spp Sarotherodon aurea 5 10 15 20 25 У додатковому втіленні, тварина є супроводжуючою твариною або людиною. Для цілей даного винаходу, термін "супроводжуючий" має бути розглянутий як такий, що включає усіх тварин - коней (кінські), котів (кошачі), собак (собачі), та гризунів, включаючи мишей, щурів, морських свинок, види кроликів, та птахів, таких, як голубі, папуги, та ін. Птахи, що одержують таку вакцинацію, можуть бути пов'язані з комерційним чи некомерційним птахівництвом. Це включає, наприклад, Anatidae, таких, як лебеді, гусаки та качки, Columbidae, наприклад, дикі голубі та голубі, такі, як домашні голубі, Phasianidae, наприклад, куріпки, шотландські куріпки та індики, Thesienidae, наприклад, домашні кури, Psittacines, наприклад, довгохвості папуги, ари, та папуги, наприклад, розведені для ринку домашніх тварин та колекторного ринку. Курей наведено у цій заявці нижче. Джерела ізолятів дикого типу Загалом, атенуйовані С. perfringens організми за даним винаходом зможуть бути одержані з С. perfringens дикого типу, що спочатку були виділені з будь-якої інфікованої тварини, що розглядається, та обговорені supra, та/або з оточуючого середовища. Оточуюче середовище включає будь-який матеріал, що містить життєздатні організми С. perfringens та/або життєздатні спори С. perfringens включаючи, наприклад, забруднений корм, ґрунт, воду, матеріал для підстилки худоби, екскременти та ін. Justin et al., [Biochemistry 41, 6253-6262 (2002)] характеризували альфа-токсини різних штамів С. perfringens, послідовності та біохімічні властивості яких майже ідентичні. Проте, Justin et al., також описують штам, що був ізольований з пташиного джерела (лебідь), що має альфатоксин, який сильний ступінь варіації послідовностей та змінену субстратну специфічність, порівняно із іншими штамами. З цієї причини, вважається, що більшість ізолятів, при перетворенні у атенуйовану форму, викликатимуть захисний імунітет проти альфа-токсину багатьох природних штамів С. perfringens. Тим не менш, маючи можливість варіації альфатоксинів в ізолятах, це часто є корисним для виділення та ослаблення С. perfringens організмів видів тварин, для яких вакцинація анти-С. perfringens є бажаною. Ізолят, проілюстрований у цій заявці нижче, був виділений з курей та протестований у цих видах. Вакцини 11 UA 109105 C2 5 10 15 20 25 30 35 40 45 50 55 Атенуйовані С. perfringens організми за даним винаходом, загалом, складають у фармацевтично придатні вакцинні композиції. Вакцинні композиції складають відповідно до маршруту введення, та вони сумісні з активним антигенним агентом. Активним антигенним агентом є, наприклад, один чи більше штамів атенуйованих організмів С. perfringens типу А за даним винаходом. Необов'язково, вакцинна композиція може також містити один чи більше типів нетоксичного альфа-протеїну, у комбінації з атенуйованими організмами С. perfringens типу А. Наприклад, практично усі атенуйовані організми С. perfringens типу А, включені у вакцинну композицію, є живими та життєздатними, хоча для деяких конкретних ситуацій, наприклад, для імунізації деяких людей чи тварин з ослабленим імунітетом, вакцина буде містити виключно вбиті атенуйовані організми С. perfringens типу А. Вакцинна композиція містить фізіологічно сумісні буфери та/або солі, у довільній комбінації з ад'ювантами та/або необов'язковими підсилювачами чи стимуляторами імунітету (введеними одночасно чи послідовно, наприклад, до чи після вакцинації). Придатні імуностимулятори включають, але не обмежуються наведеним, цитокіни, фактори росту, хемокіни, супернатанти клітинних клітинних культур лімфоцитів, моноцитів, клітини лімфоїдних органів, клітинні препарати чи клітинні екстракти (наприклад, Staphylococcus aureus чи ліпополісахаридні препарати), мітогени, чи ад'юванти, включаючи низькомолекулярні ліки. Імуностимулятори можуть бути введені in ovo у будь-який час протягом інкубації. У конкретному аспекті, імуностимулятор вводять у середовище, що містить атенуйовані організми С. perfringens типу А. Способи введення вакцин Вищеописані вакцини за даним винаходом вводять, наприклад, шляхом ін'єкції чи інокуляції одним чи комбінацією маршрутів: пероральним, інтраназальним, парентеральним, підшкірним, скарифікацією та/або внутрішньом'язовим введення у будь-якій придатній, відомій з рівня техніки композиції, наприклад, сумісному буфері та/або фізіологічно придатному сольовому розчині, у довільній комбінації з адювантами та/або підсилювачами чи стимуляторами імунітету (одночасним або послідовним введенням, наприклад, до чи після вакцинації). Для способів перорального введення вакцин/вакцинування, легко застосовують будь-які фізіологічно придатні буфери чи суспендуючі агенти, відомі з рівня техніки. Додатково, композиція може бути включена, наприклад домішана у питну воду чи розпилена на кормові таблетки, розпилена на кукурудзяні чи інші зерна, та ін. Шлунково-кишковий тракт є розповсюдженим місцем інфікування С. perfringens, тому пероральне введення охоплене як один зі способів інокуляції. Присутність у шлунковокишковому тракті живих атенуйованих організмів С. perfringens за даним винаходом розглядають як таку, що викликає локальні захисні імунні реакції у слизовому шарі шлунковокишкового тракту, та може також діяти конкурентно для попередження наступної колонізації С. рerfringens дикого типу. Для птахів, таких, як домашні птахи, включаючи курей, качок, гусей та ін., серед корисних маршрутів вакцинації наявні пероральний спосіб, чи ін'єкція in ovo. Маршрут in ovo проілюстрований у цій заявці нижче, та він призводить до активної імунізації та захисту від інфікування курей-несучок. Експресія чужорідних генів С. Perfrinpens За допомогою методів, розвинених у наведених вище Прикладах, будь-який ген, що не зустрічається у природі, тобто, чужорідний до С. Perfringens необов'язково може бути введений у хромосомальні ДНК С. perfringens. Для експресії чужорідних протеїнів, може бути здійснене генне злиття, що зберігає фланкуючі послідовності гена альфа-токсину, промотору альфатоксину та його сигнальну послідовність. В одному втіленні, більшість кодуючих послідовностей гена рlс заміщена чужорідним геном. Нуклеотиди, що залишилися, гена рlс під введеним геном, не включені до каркасу, тому функціональний альфа-токсин не продукується. Альтернативно, чужорідний ген може бути введений у каркас нуклеотидної послідовності, що кодує альфатоксиновий мутеїн, що утворює протеїн злиття альфа-токсин - чужорідний протеїн. Олігонуклеотидні праймери для чужорідного гена можуть бути синтезовані, наприклад, з Nкінцевою FLAG міченою послідовністю та відповідними сайтами рестрикції. Продукти ПЦР можуть бути клоновані у суїцидний вектор; мітка FLAG та чужорідний ген вводять у каркас з альфа-токсиновою сигнальною послідовністю. Чужорідний протеїн експресується під контролем альфа-токсинового промотору та націлений на секрецію сигнальною послідовністю рlс. Секретований чужорідний протеїн може бути визначеним у супернатантному середовищі за методом Вестерн-блоттінг з використанням анти-FLAG антитіла. 12 UA 109105 C2 5 10 15 20 25 30 35 40 45 50 55 60 У такий спосіб у геном С. perfringens може бути введений будь-який придатний чужорідний ген. Це включає, наприклад, ДНК кодуючі антигени патогенів шлунково-кишкового тракту, включаючи, наприклад, антигенні протеїни таких бактерій, як E. соlі, вид сальмонела, вид кампілобактер, вид lawsonia, та ін.; антигенні протеїни таких паразитів, як вид еймерія, вид ізоспора, вид криптоспорідум та ін.; та антигенні протеїни таких вірусів, як ротавіруси, коронавіруси та ін., для імунізації тварини, яку лікують таким рекомбінантним С. perfringens. Інші протеїни, що можуть бути експресовані таким рекомбінантним С. Perfringens, включають терапевтичні протеїни чи пептиди. Необов'язково, вони включають пептиди, що є ендогенними до шлунково-кишкового тракту, включаючи трифоль фактор, чи будь-який цитокін. Відомий з рівня техніки, наприклад курячий IL-18, та ін. Один такий конструкт С. perfringens експресує курячий IL-18 протеїн. Введення живих бактерій, що містять генне злиття, дозволятиме доставку терапевтичних доз IL-18 у кишку, що є відносно безпечним для тварини-хазяїна, завдяки відсутності продукування альфа-токсинів. Інші терапевтичні агенти також можуть бути експресовані за допомогою цієї системи. У цій заявці процитовано численні посилання, зміст кожного з яких повністю включено до цієї заявки шляхом посилання. Наступні конкретні Приклади включені для ілюстрації, та не призначені для обмеження обсягу даного винаходу, якщо не вказано інше. Приклад 1 Вектор гомології делетантного альфа-токсину с. perfringens Був створений гомологічний плазмідний вектор 1162-55-20, корисний для конструювання делетантів альфа-токсину С. perfringens. Плазміда включає декілька важливих елементів; регіон реплікації плазміди pUC18 Е соlі; хлорамфенікол (catP) С. perfringens та еритроміцин (ermBP) резистентні гени (обидва з яких також експресуються у Е. соlі); та альфа-токсиновий ген (рlс) С. perfringens, інактивований специфічною делецією 9 амінокислот. Плазміда 1162-55-20 створена у декілька стадій, наступним чином. Спочатку ген рlс клонували з останнього пташиного ізоляту С. perfringens (штамСР6). Послідовність С. perfringens штаму 13 (Genbank NC 003366; SEQ ID NO: 2) використовували для конструювання олігонуклеотидних праймерів для використання у клонуванні гена рlс. Ці та усі наступні праймери одержували комерційно від Sigma Genosys, Woodlands, ТХ. Верхній праймер, розташований у гені yрlс (СРЕ0035), 5' AGCTGCATAAGCAAAAGTTCCAACTC 3' (SEQ ID NO: 14) відповідає нуклеотидам 47675-47700 штаму 13 (SEQ ID NO: 2). Нижній праймер, розташований у гені соbW (СРЕ0037), 5' GCAGAAACTCTTCTTAGACCTATTCTTTTAGGC 3' (SEQ ID NO: 15), є комплементарним нуклеотидам 50597-50629 штаму 13. Ці праймери використовували разом із геномною ДНК С. perfringens штаму СР6 у довгій полімеразній ланцюговій реакції (ПЦР). Продукт 2955 основних пар від верхнього гена yрlс до нижнього гена cob W був передбачений з відомої послідовності штаму 13 (як показано на Фіг. 1). Промотор альфа-токсину, сигнальна послідовність та кодуюча послідовність гена рlс (СРЕ0036) містилися у цьому фрагменті, тобто між верхнім геном yрlс та нижнім геном cob W. ПЦР 2955 фрагмент основних пар потім клонували у вектор клонування pCR-Blunt (Invitrogen Corporation, Carlsbad, CA) що призвело до утворення плазміди 1162-52.1. Нуклеотидна послідовність кодуючого регіону рlс 2955 фрагмента основних пар штаму СР 6, визначали з цього фрагмента (SEQ ID NO: 22; а відповідним поліпептидом був SEQ ID NO: 23), та було показано, що вона є практично гомологічною послідовності гена рlс С. perfringens штаму 13(SEQ ID NO: 2). Потім регіон реплікації Е. соlі та С. perfringens гени резистентності клонували з шаттлплазміди pJIR418 (Sloan, et a/, 1992, Plasmid 27, 207-219; Genebank M77169). Плазміду pJIR418 розрізали рестриктазами Bam НI та Spe І та кінці наповнювали полімеразою Кленоу. Лігація великого фрагмента призводила до утворення плазміди 1162-45.1 та збереження сайта рестрикції Ват НІ. Ця плазміда зберігала регіон реплікації Е. соlі, проте, на відміну від pJIR418, не містив джерело реплікації С. perfringens. Тому плазміда була здатна до автономної реплікації у Е. соlі, але не у С. perfringens. На наступній стадії С-кінцева половина гена рlс була субклонована у проміжну плазміду 1162-45.1. Розрізання плазміди 1162-52.1 з Ваm НІ та Eco RI вивільняла 1742 фрагмент основних пар, що містив С-кінцеву частину гена альфа-токсину унікального сайта Bam НІ, розташованого у нижньому гені рlс до гена cob W до сайта Eco RI, розташованого у множинному сайті клонування батьківського плазміди. Фрагмент основних пар 1742 клонували між сайтами Bam НІ та Eco RI, розташованими у множинному сайті клонування плазміди 116245.1. В утвореній у результаті плазміді 1162-53.7, С-кінцева половина гена рlс має таку ж саму транскрипційну орієнтацію, що і гени catP та еrmВР батьківського плазміди. На останній стадії, N-кінцеву половину гена рlс клонували в унікальний сайт Bam HI плазміди 1162-53.7. Це було здійснено шляхом створення фрагмента ПЦР, одержаного з гена 13 UA 109105 C2 5 10 15 20 25 30 35 40 альфа-токсину, субклонованого у плазміду 1162-52.1. Верхній праймер, 5' ggatccAGCTGCATAAGCAAAAGTTCCAACTC 3' (SEQ ID NO: 16) був ідентичний попередньо відміченому праймеру yрlс (SEQ ID NO: 4), за винятком того, що був включений фланкуючий сайт Bam HI (нижній). Нижній праймер, розташований у гені альфа-токсину, 5' ggatccaATGCATTCTTATCATAATCTGGATAAGTAGAACC 3' (SEQ ID NO: 17) був комплементарний нуклеотидам 48824-48857 штаму 13 та включений у фланкуючий сайт рестрикції Ваm НІ та спейсерний нуклеотид для зберігання рамки зчитування (нижньої). Фрагмент Ваm НІ, утворений у результаті ПЦР, з цими праймерами та плазмідомною 1162-52-1 темплатною ДНК клонували в унікальний сайт Bam HI плазміди 1162-53.7. Була виділена плазміда, що містила два регіони гена рlс у такій самій транскрипційній орієнтації. Ця плазміда 1162-55.20 містила ген рlс з бажаними дев'ятьмаамінокислотними делеціями та додаванням лейцинового залишку між аlа 61 та asp 71 токсину дикого типу (див. Фіг. 2). Секвенування ДНК плазміди підтвердило рамку зчитування та чисту делецію 24 кодонів (що кодують вісім амінокислотних залишків). Пприклад 2 Конструювання рекомбінанту cperf001 clostridium perfringens Делетовану версію гена рlс, сконструйовану у Прикладі 1, вводили у С. perfringens з використанням наступної стратегії. Вектор гомології 1162-55.20 мав назву С. perfringens "суїцидна плазміда", оскільки його джерело реплікації С. perfringens було видалено. Коли плазміду трансформували у С. perfringens, то її було неможливо реплікувати та вона не виживала. Проте, якщо трансформовані бактерії поміщали у селекцію хормафеніколу та/або еритроміцину, то плазмідна ДНК могла бути примусово рекомбінована у бактеріальний геном через гомологію до гена рlс. Рекомбінантні бактерії, одержані у результаті, мали назву інтегрантів. Інтегрант містив копію введеного вектора гомології, що був інтегрований у локус гена рlс. Таким чином, одержаний у результаті інтегрант містив дві копії гена рlс, оригінальну нормальну копію та введену делетовану версію. Введені резистентні гени були розташовані між двома копіями гена рlс. Коли антибіотичну селекцію видаляли з інтегранту, то відбувалася рекомбінація між двома копіями гена рlс. Ця рекомбінація могла призводити до одного з двох результатів. В обох випадках, ДНК між двома копіями гена рlс (включаючи резистентні гени) була видалена. У першому випадку, був збережений нормальний ген рlс, що призводило до відновлення оригінального батьківського штаму. У другому випадку, нормальний ген рlс був замінений делетованою копією, що призводило до утворення бажаного делетованого конструкту альфа-токсину. Оскільки альфа-токсин делетованого штаму був інактивований, цей штам був негемолітичним. Тому бажаний делетантний інтегрант був ідентифікований для скринінгу негемолітичних клонів на кров'яних агарових планшетах. Оскільки очікувалося, що рекомбінація, призводить до утворення бажаного інтегранту, відбувається нечасто, то критичним було застосування батьківських штамів С. perfringens., що мали трансформатну ефективність. Тому деякі останні пташині ізоляти С. perfringens були проаналізовані на предмет трансформаційної ефективності. Ізоляти трансформували шаттлплазмідою pJIR418, як описано Allen and Blaschek (Applied and Environmental Microbiology 54:2322 (1988)) з деякими модифікаціями (що описані нижче). Штам 1240 проявляв найвищу 6 трансформаційну ефективність (див. Таблицю 1), 9,210 трансформантів/мкг pJIR418 плазмідної ДНК. Цей штам був вибраний для конструювання делетованого CPERF001. Штам 29 був вибраний як батьківський штам для CPERF002. 45 Таблиця 1 Ефективність трансформації пташиних ізолятів С. perfringens С. perf. А штам 29 23 1220 1240 СР-2 1230 5227 5230 трансформантів/мкг pJIR418 4 3,610 2 5,610 6 4,010 6 9,210 відсутня 3 7,110 відсутня відсутня 14 UA 109105 C2 5 10 15 20 25 30 35 40 45 50 55 60 Джерелом вищезазначених штамів дикого типу був Dr. J. Glenn Songer, Dept. of Veterinary Sciences and Microbiology, University of Arizona, Tucson, Arizona 85721 Клітини С. perfringens штаму 1240 з нічної анаеробної культури у середовищі TSYC (30 г/л триптичного соєвого бульйону, 5 г/л дріжджового екстракту, 0,5 г/л цистеїну) розводили 1:25 та вирощували до А600=0,5436. Після центрифугування 100 мл клітин при 18,000 х g протягом 10 хвилин, електрокомпенетнті клітини готували шляхом подвійного повторного суспендування клітин у рівному об'ємі попередньо відновленого сахарозного фосфату магнію ("SMP" готували як 270 мМ сахарози, 1 мМ МgСl2, 7 мМ NaPO4, pH 7,3) буферу з наступним кінцевим повторним суспендуванням 0,5 мл SMP. Це призводило до одержання кінцевого об'єму у ~2,0 мл. Аліквоти 100 мкл клітин піддавали електропорації з 4 мкг плазміди 1162-55.20 у кюветах на 0,2 cм. Bio-Rad Gene Pulser II використовували при 1,37 кВ, опору у 100 ОМ та ємності у 50 мікрофарад. Відразу після електропорації, клітини розводили 2,0 мл попередньо розведеного триптичного соєвого дріжджового цистеїнового середовища ("TSYC" готували як 30 г триптичного соєвого бульйону, 5 г дріжджового екстракту, 0,5 г цистеїну, 950 мл води) та інкубували протягом 3 годин при 37 °C в анаеробній посудині. Після періоду відновлення, розведення клітин помішали на планшети TSYC+25 мкг/мл хлорамфеніколових планшет. Ці планшети інкубували при 37 °C у анаеробній посудині. Після зростання протягом ночі, спостерігали у середньому 50 хлорамфенікол-резистентних колоній на мікрограм 1162-55.20 ДНК. Одинарні колонії семі передбачених інтегрантів вирощували у неселективних середовищах TSYC для чотирьох послідовних результатів та поміщали на селективні кров'яні агарові планшети. Один з неселективних штамів, 1192-31.7, проявляв декілька негемолітичних колоній. Двадцять одна з цих негемолітичних колоній поміщали на неселективні контрольні планшета та реплікаційні планшети на TSYC + хлорамфеніколові планшети. Дві з цих 21 колоній були хлорамфенікол-чутливими. Один з хлорамфенікол-чутливих передбачених делетантів, 1192-32.14, вирощували до 1240 дикого типу та інтегранту 1192-31.7 та поміщали на кров'яні агарові планшети. Штам 1240 дикого типу проявляв чіткі зони бета гемолізу, тоді як делетант 1192-32.14 був чистою культурою негемолітичних колоній та був перейменований CPERF001. Інші кров'яні планшети використовували як контрольні та реплікаційні для неселективних та селективних середовищ. 1240 дикого типу та були чутливі до хлорамфеніколу та еритроміцину. Інтегрант, 1192-31.7, як і очікувалося, був резистентний як до хлорамфеніколу, так і до еритроміцину. Для виключення можливості того, що гени, резистентні до антибіотиків, присутні, але не експресуються у CPERF001, ПЦР праймери, були синтезовані гени специфічні для хлорамфеніколу та еритроміцину у реакціях ПЦР. Геномні ДНК одержували зі штамів дикого типу, інтегрантів та штамів CPERF001, та використовували як темплати для реакцій ПЦР з антибіотичними генними праймерами. Результати ПЦР аналізу проявляли позитивний відклик тільки на суїцидну плазміду та інтегрант, а не на батьківський 1240 чи делетантний CPERF001. Це підтвердило передбачувану втрату резистентних генних послідовностей. Для підтвердження делеції у гені альфа-токсину, регіон 1086 bр, оточуючий делецію, ампліфікували за допомогою ПЦР з використанням придатних альфа-токсинових специфічних праймерів. Ампліфіковані фрагменти клонували та секвенували. Результати секвенування підтверджували делецію дев'яти амінокислот від tyr 62 до trp 70 гена альфа-токсину та інсерцію одинарного leu (див. Фіг. 2А-2С). CPERF001 оцінювали на предмет експресії інактивованого альфа токсоїдного протеїну. Через 6 годин анаеробного зростання, аліквоти 1 мл клітин збирали та центрифугували. П'ятнадцять мікрограм неконцентрованих супернатантних середовищ аналізували поліакриламідним гель-електрофорезом та піддавали аналізу Вестерн-блоттінг з кролячим поліклональним антитілом, направленим проти рекомбінантного альфа-токсинового протеїну {Vaccine 1Ц12): 1253-1258 (1993)). Результати показали специфічну реактивність антитіл з протеїном очікуваного розміру до альфа-токсоїдного протеїну. CPERF001 є генетично сконструйованим делетантним штамом С. perfringens типу А. Цей штам секретує інактивовану токсоїдну форму альфа-токсину С. perfringens. Оскільки цей штам більше не експресує активний альфа-токсин, а зберігає значну частину антигенності токсину, він буде корисним як вакцина для захисту від хвороби, викликаної С. perfringens. Приклад 3 Конструювання рекомбінанту cperf002 clostridium perfringens Для компенсації зниженої трансформаційної ефективності штаму 29 С. perfringens (див. Таблицю 1, supra) був сконструйований новий вектор гомології. Новий вектор включав послідовності С. perfringens, клоновані безпосередньо з геному штаму 29. Було передбачено, 15 UA 109105 C2 5 10 15 20 25 30 35 40 45 50 55 60 що це призведе до більш ефективної стадії рекомбінації. Новим вектором був 1192-38.3, створений наступним чином. На першій стадії регіон реплікації E. соlі та резистентні гени С. perfringens клонували з шаттл-плазміди pJIR418 (Sloan et al, Plasmid 27, 207 (1992); Genebank M77169). Плазмід pJIR418 дигестували рестриктазою Ndel. Лігування великого фрагмента призвело до утворення плазміди 1192-23.1. У цієї плазміди було відсутнє джерело реплікації С. perfringens, але на відміну від плазміди 1162-45.1, що була сконструйована у Прикладі 1, вона зберігала весь множинний сайт клонування р JIR418 На наступній стадії С-кінцева половина гена рlс була субклонована у проміжну плазміду 1192-23.1. Геномна ДНК штаму 29 була використана як темплата довголанцюгового ПЦР. Регіон гена рlс (альфа-токсин) від сайта Bam HI до частини гена СРЕ0038 був ампліфікований. Верхній праймер рlс, 5' CTGGGATCCTGATACAGATAATAATTTCTCAAAGGAT 3' (SEQ ID NO: 18) відповідає нуклеотидам 48880-48916 штаму 13 (Genbank NC 003366). Нижній праймер у гені СРЕ0038, 5' actctgcagTTGTCATATCAATTAAATTAACTATAATCCC 3' (SEQ ID NO: 19) є комплементарним нуклеотидам 51244-51275 штаму 13 та містить фланкуючі нуклеотиди, включаючи сайт рестрикції Pst І (нижній). Продукт основних пар 2402 був одержаний та дигестований рестриктазами Bam HI and Pst І. Цей фрагмент був лігований з великим фрагментом Ваm НІ та Pst І дігестований 1192-23.1 з утворенням плазміди 1192-36.10. На останній стадії N-кінцеву половину гена рlс клонували за допомогою ПЦР. Верхній праймер, 5' actgagctcCTAGACACTTTGCTTCAATATTTGGGAA 3' (SEQ ID NO: 20) відповідає нуклеотидам 46513-46540 штаму 13 та включає фланкуючі нуклеотиди та сайт Sac І (нижній). Нижній праймер, 5' actggatccGCATTCTTATCATAATCTGGATAAGTAGAACC 3' (SEQ ID NO: 21) є комплементарним нуклеотидам 48824-48855 штаму 13 та включає фланкуючі нуклеотиди та сайт Bam HI. Продукт основних пар 2363 був одержаний та дигестований рестриктазами Sac І та Ваm НІ. Дигестований фрагмент був лігований з великим фрагментом Sac І та Ваm НІ дігестований 1192-36.10 з утворенням плазміди 1192-38.3. Послідовне секвенування регіону, фланкуючого рlс Ваm НІ сайта у 1192-38.3 підтверджено делецією дев'яти амінокислот від tyr 62 до trp 70. Плазміда 1192-38.3 була використана для електропорації клітин штаму 29 С. perfringens. Попередньо було показано, що штам 29 трансформує з ефективністю 3,6104 трансформантів/мкг pJIR418 плазміди ДНК. Клітини штаму 29 вирощували та піддавали електропорації, як у Прикладі 2, за винятком того, що використовували методику рідкої селекції через тригодинний період відновлення. Замість поміщення у планшету, 0,67 мл аліквот клітин розводили у 12 мл TSYC+25 мкг/мл хлорамфеніколу та вирощували усю ніч при 37 °C в анаеробній посудині. Ця модифікація була використана через низьку ефективність трансформації та вирощування на планшеті штаму 29 порівняно із 1240. Після вирощування протягом ночі, клітини розводили знову у селекційних середовищах. Клітини другого збору потім п'ять разів пропускали без селекції до вирощування на кров'яній агаровій планшеті. Жодні з колоній з кров'яних агарових планшет були негемолітичні. Дві кров'яні планшети були потім повторно поміщені на TSYC, TSYC+25 мкг/мл хлорамфенікол та TSYC+50 мкг еритроміцинові планшети. Усі колонії були чутливі до еритроміцину, але тільки одна з 130 колоній була чутлива до хлорамфеніколу. Ця колонія, 1192-45.4В, була перейменована на CPERF002. Аналіз ПЦР геномної ДНК CPERF002 специфічними праймерами альфа-токсинів, показав позитивну смугу альфа-токсинів. Ця смуга була меншою за відповідну смугу штаму 29 ДНК дикого типу. Праймери, специфічні для генів до резистентних хлорамфеніколу та еритроміцину не ампліфікували CPERF002 ДНК, але проявляли сильні позитивні смуги плазміди 1192-38.3. Секвенування CPERF002 альфа-токсину підтвердило делецію дев'яти амінокислот (див. Фіг. 3). CPERF002 оцінювали на предмет експресії інактивованого альфа токсоїдного протеїну. Через 6 годин анаеробного зростання, аліквоти у 1 мл клітин збирали та центрифугували. П'ятнадцять мікролітрів неконцентрованого супернатантого середовища аналізували поліакриламідним гель-електрофорезом та піддавали аналізу Вестерн-блоттінг з кролячим поліклональним антитілом, направленим проти рекомбанінтного альфа-токсоїдного протеїну (Vaccine 11: 1253 (1993)). Результати показали специфічну реактивність антитіла з протеїном очікуваного розміру щодо альфа токсоїдного протеїну. CPERF002 є генетично сконструйованим делетантним штамом С. perfringens типу А. Цей штам секретує інактивовану токсоїдну форму альфа-токсину С. perfringens. Оскільки цей штам більше не експресує активний альфа-токсин, але зберігає значну частину антигенності токсину, він буде корисним як вакцина для захисту від хвороби, викликаної С. perfringens. Приклад 4 Делетантні вакцини с. perfringens 16 UA 109105 C2 5 Делетантні штами вакцини CPERF001 та CPERF002, описані у Прикладах 2 та 3, оцінювали на здатність до надання захисту від інфікування С. perfirngens дикого типу. Перша частина дослідження була розроблена для визначення, чи буде мати введення живих штамів вакцини несприятливий ефект на виводимість ембріонованих яєць. Призначення експериментальних груп та результати безпеки наведено у Таблиці 2 Таблиця 2 РЕЗУЛЬТАТИ БЕЗПЕКИ Група* 1 2 3 4 5 6 7 8 9 10 11 12 10 15 20 Вакцина (доза)** 2 х CPERF001 (0,810 ) 3 CPERF001 (0,810 ) 4 CPERF001 (0,810 ) 5 CPERF001 (0,810 ) 2 CPERF002(1,910 ) 3 CPERF002(1,910 ) 4 CPERF002(1,910 ) 5 CPERF002(1,910 ) 3 Штам 1240 (1,510 ) 3 Штам 29 (3,710 ) Контроль середовища Неінокульований контроль Кількість знесених яєць (%) 18 (90 %) 17 (85 %) 11 (55 %) 16 (80 %) 16 (80 %) 17 (85 %) 14 (70 %) 12 (60 %) 16 (80 %) 13 (65 %) 19 (95 %) 18 (90 %) * 20 яєць на групу ** 100 мкл дози, введеної in ovo на 18 день ембріонування (IМ) x Титр доз виміряний як колонієутворюючі одиниці (cfu") 3 При дозі у 10 чи менше (групи 1, 2, 5, та 6), виводимість у цих групах не була значно нижча за виводимість у групі, інокульованій тільки середовищем (група 12). При найнижчій дозі CPERF001 показала таку ж виводимість, що й контроль середовища, та кращу, ніж інокульована контрольна група. Оскільки більш високі дози делетантів могли мати несприятливий вплив на виводимість яєць, то тільки дві групи найнижчого дозування були включені у ефективну частину дослідження. Ці групи, разом із птахами контролю середовища (група 11), були інфіковані 8 (дикого типу) С. perfringens штамом СР6, що був введений перорально при, приблизно, 10 cfu/мл/птах, коли птахам було 20, 21 та 22 дні. Усі птахи були некротизовані на 25 день життя, а ураження тонкого кишечнику оцінювали по балам з використанням шкали балів на предмет некротичного ентериту, результати оцінювання наведено нижче. 0 балів Відсутність великих уражень NE у тонкому кишечнику; кишечник має нормальну еластичність (повернення до власного рівня після відкриття) некротичний ентерит 1+ Тонкі та слабкі стінки кишечнику (кишечник залишається плоским при відкриванні та не повертається у нормальний стан); надлишок чи більш густий слиз, що покриває слизову мембрану чи фокальне чи мультифокаль не почервоніння слизу чи закупорка серозальних судин некротичний ентерит 2+ некротичний ентерит 3+ некротичний ентерит 4+ Одна чи декілька мультифокаль них зон почервоніння та припухання стінок кишечнику; одна чи декілька мультифокаль них зон виразок та некрозу кишкової слизової оболонки Обширні мультифокаль ні зони некрозу та виразки кишкової слизової оболонки ± значна кровотеча чи шар фібрину чи некротичні прояви на поверхні слизової оболонки (вигляд махрового рушника) Мертва тварина з великими ураженнями NE, 2+ бали чи більше 17 UA 109105 C2 5 Підрахунок незначних модифікацій відповідно до Charles Hofacre, D.V.M., М.А.М., Ph.D., University of Georgia, Poultry Diagnostic and Research Center, 953 College Station Road, Athens, GA 30602, П'ять (5) птахів з невакцинованої контрольної групи (не інфікованої) були розкриті наприкінці дослідження для підтвердження відсутності впливу С. perfringens протягом дослідження. Результати представлено у Таблиці 3. Таблиця 3 ГРУПИ ЛІКУВАННЯ ДЛЯ ЗАХИСТУ* доза вакцини Група* Вакцина Дні визначення С. perfringens іn-ovo (cfu) 2 1 CPERF001 20, 21 та 22 110 3 2 CPERF001 20, 21 та 22 110 2 5 CPERF002 20, 21 та 22 110 3 6 CPERF002 1 × 10 20, 21 та 22 Контроль 11 Відсутня 20, 21 та 22 середовищ 12 Відсутня Відсутня Не інфікували 10 15 20 25 30 35 40 РЕЗУЛЬТАТИ N середнє 9 13 12 12 0,67 0,46 1,33 1,08 15 1,80 5 0,00 * некропсія на 25 день визначення Бали для Груп 1 та 2 кожна була статистично значуще нижче порівняно із Групами 11 (Wilcoxon Exact Rank Sum Test p0,0250). Середні бали для Груп 5 та 6 були нижчу за бали Групи 11, але не були статистично різні (Wilcoxon Exact Rank Sum Test p0,2177). Оцінка ефективності вакцин була здійснена відповідно до процедур, описаних David Siev [Journal of Modern Applied Statistical Methods Vol. 4, No. 2, 500-508 (2005)]. Ефективність вакцин щодо зниження тяжкості хвороби була оцінена як 54 % для Групи 1, 65 % для Групи 2, 20 % для Групи 5 та 27 % для Групи 6 порівняно із Групою 11. Приклад 5 Конструювання свинячого делетанту с. perfringens Стратегії, використані у Прикладах 1 та 2, supra, використовували для конструювання делетантних мутантів альфа-токсину зі свинячих штамів С. perfringens. Спочатку польові ізоляти хворих свиней піддавали електропорації з плазмідою pJIR418 для оцінки їх здатності до 4 трансформації. Вихід ізолятів становив 10 трансформантів на мікрограм плазмідної ДНК, та вони були чутливі до хлорамфеніколу чи еритроміцину, та були кандидатами для делеції. Геномну ДНК від кандидатних штамів використовували як темплату для довголанцюгової гена рlс (альфа-токсин) та фланкуючих послідовностей. Після субклонування продуктів ПЦР, ген альфа-токсину та фланкуючі регіони секвенували та рестрикційно картували. Нові олігонуклеотидні праймери синтезували з фланкуючими сайтами рестрикції, а продукти двох окремих ампліфікацій клонували у суїцидну плазміду 1192-23.1 для створення делеції 27 основних пар, як у Прикладі 1. Свинячий суїцидний вектор піддавали електропорації у відповідний свинячий штам С. perfringens та мутантні делеції ізолювали способами, описаними у Прикладі 2, supra. У мутантних делеціях була підтверджена відсутність бета-гемолізу на кров'яних агарових планшетах та ДНК секвенуванням гена альфа-токсину. Цей конструкт є генетично сконструйованим делетантним штамом С. perfringens типу А. Цей штам секретує інактивовану токсоїдну форму С. perfringens альфа-токсину. Оскільки цей штам більше не експресує активний альфа-токсин, а залишає значну частину антигенності токсину, він є корисним як вакцина для захисту свиней від хвороб, викликаних С. perfringens. Біологічне депонування Культури наступних біологічних матеріалів були депоновані у наступному міжнародному депозитарії: Американська Колекція Типових Культур (АТСС) 10801 University Boulevard, Manassas, Va. 20110-2209, U.S.A., за умов, що відповідають вимогам Будапештської Угоди щодо міжнародного визнання депонування мікроорганізмів для патентування. 18 UA 109105 C2 Організм Clostridium perfringens CPERF/Δαтоксин 365-054 Clostridium perfringens CPERF/Δαтоксин 365-053 Номер доступу Дата депонування PTA7364 7 лютого, 2006 p. PTA7365 7 лютого, 2006 p. ПЕРЕЛІК ПОСЛІДОВНОСТЕЙ 5 19 UA 109105 C2 20 UA 109105 C2 21 UA 109105 C2 22 UA 109105 C2 23 UA 109105 C2 24 UA 109105 C2 25 UA 109105 C2 26 UA 109105 C2 27 UA 109105 C2 28

Додаткова інформація

Автори російською

Cochran Mark D., Petersen Gary, Lair Steven V., Synenki Richard

МПК / Мітки

МПК: A61K 39/08, A61K 35/74, C07H 21/04, C07K 14/33

Мітки: кислоти, кодує, нуклеїнової, істотно, молекула, альфа-токсину, clostridium, perfringens, мутеїн, нетоксичний

Код посилання

<a href="http://uapatents.com/34-109105-molekula-nuklenovo-kisloti-shho-kodueh-istotno-netoksichnijj-muten-alfa-toksinu-clostridium-perfringens-ta-istotno-netoksichnijj-muten-alfa-toksinu-clostridium-perfringens.html" target="_blank" rel="follow" title="База патентів України">Молекула нуклеїнової кислоти, що кодує істотно нетоксичний мутеїн альфа-токсину clostridium perfringens, та істотно нетоксичний мутеїн альфа-токсину clostridium perfringens</a>

Подібні патенти