Штам реліктових бактерій bacillus sp. f, що має імуномодулюючу активність і геропротекторну здатність

Завантажити PDF файл.

Формула / Реферат

Штам реліктових бактерій Bacillus sp. F із значно вираженими геропротекторними властивостями і імунорезистентністю.

Текст

Штам реліктових бактерій Bacillus sp. F із значно вираженими геропротекторними властивостями і імунорезистентністю. Винахід належить до біотехнологій, зокрема до промислових штамів мікроорганізмів, і отримання імуномодулючих і геропротекторних препаратів. В умовах інтенсивного хімічного забруднення середовища проживання людини, вживання медикаментів, заснованих на хімічному синтезі, зв'язано з появою в організмі людини побічних ефектів і у ряді випадків - з низькою ефективністю фармпрепаратів, що використовуються. Тому в передових в технологічному відношенні (в частині молекулярної біології і генетики) країнах ведуться інтенсивні пошуки методів отримання лікарських засобів, заснованих на використовуванні рослинної і мікробіологічної сировини. Одержані при цьому фармпрепарати відрізняються від синтетичних продуктів великою різноманітністю структур і фізико-хімічних властивостей, оскільки рослини і мікроорганізми утворилися в природі по схемах біоценозу, що сформувалися протягом тисячоліть, близькі тваринним організмам і легко залучаються до процесів обміну, а в рослинних зразках і мікроорганізмах природа часто створює фармакоформи, які не мають аналогів в синтетичних продуктах. Відомий штам бактерії Bacillus subtilis P-l - переважно як продуцент протеази (патент RU 2208633, 2001 p.). Відомий також штам бактерій Bacillus macroides Excel 00, виділений з міцелію лікарського гриба Agaricus Blazei Murill, що проявляє імунну активність і здатність перешкоджати старінню і хворобам (заявка JP 2008-005702 А, 2008p.). Основним недоліком вказаних штамів є тривалість процесу культивування і необхідність вирощування на дорогих живильних середовищах, що включають нестандартні і рідкісні харчові компоненти, а також нестабільність біологічних продуктів. Відомий штам бактерій Bacillus subtilis 1779 (прототип), по видовій подібності найближчий до штаму, що заявляється, виділений в природних умовах, проявляючий широкий спектр активності антагоніста, низьку адгезивну здатність, імуномодулюючу активність і продукуючий комплекс гідролітичних ферментів (патент RU 2298032, 2007 p.). Проте вузька сировинна база для штамупрототипу, обмежений діапазон живильних середовищ для його культивування, відсутність даних про його геропротекторні властивості, імуномодулюючі здібності і по фармакокінетиці в досліджен (19) UA (11) 96709 (13) C2 (21) a201014192 (22) 29.11.2010 (24) 25.11.2011 (46) 25.11.2011, Бюл.№ 22, 2011 р. (72) СОКОЛОВСЬКИЙ ІВАН ІВАНОВИЧ, ГРІВА ГЄННАДІЙ ІВАНОВІЧ, RU, БРУШКОВ АНАТОЛІЙ ВІКТОРОВІЧ, RU, СОКОЛОВСЬКИЙ СЕРГІЙ ІВАНОВИЧ (73) СОКОЛОВСЬКИЙ ІВАН ІВАНОВИЧ, ГРІВА ГЄННАДІЙ ІВАНОВІЧ, RU, БРУШКОВ АНАТОЛІЙ ВІКТОРОВІЧ, RU, СОКОЛОВСЬКИЙ СЕРГІЙ ІВАНОВИЧ (56) JP 2008005702 A, 17.01.2008. RU 2298032 C2, 27.04.2007. RU 2208633 C1, 20.07.2003. UA 80995 C2, 26.11.2007. 3 нях in vivo вимушують вести пошук інших штамів з більш високими споживчими характеристиками. Задачею пропонованого винаходу є виділення нового штаму з розширеною і легкодоступною сировинною базою і який має чітко виражені геропротекторні властивості і імунорезистентність. Для вирішення поставленої задачі пропонується штам реліктової бактерії Bacillus sp. F із чітко вираженими геропротекторними властивостями і імунорезистентністю, задепонований в Депозитарії Інституту мікробіології і вірусології Національної академії наук України. Штам виділений із стародавніх багаторічномерзлих порід верхнеплейстоценового віку в геологічному оголенні Мамонтової гори (Центральна Якутія). В польових умовах з багаторічномерзлих товщ переважно піщаного складу за допомогою стерильних інструментів відбиралися зразки мерзлих порід непорушеної структури вагою 4-6 кг. Транспортування відібраних монолітів в лабораторію здійснювалося без їх відтавання при температурі, близькій до природної (-5 °C). В лабораторних стерильних умовах з центру зразка витягували пробу розміром приблизно 3×4 см, поміщали на 23 с в 96 % розчин етанолу, після чого обпалювали в полум'ї спиртівки, відтавали при кімнатній температурі і переносили на живильні середовища. Культивування штаму здійснювалося на стандартних середовищах YPD, MRS, LB, NA і інших по загальноприйнятій схемі (Manual environmental microbiology. 1997. Ed. Hurst C.J. FSM Press. Washington DC. 894 p.), а також на рідкому м'ясопептонному бульйоні в анаеробних і аеробних умовах. Штам являє собою слабо рухомі прямі палички із закругленими кінцями розмірами (1-1,2)×(3-10) мкм, по 1-2 ланцюжки і іноді до 7, ендоспори бацилярного типу, грампозитивний, психротолерантний, факультативний анаероб. На щільних живильних середовищах утворює непрозорі блискучі м'які колонії жовтуватого кольору. Зростання при температурі від +5 до +43 °C і рН 5-12. Рибосомальна ДНК мікробної культури витягувалася по методиці Fast DNA kit for soil (BIO 101 Inc., Vista, CA), заснованій на руйнуванні клітини скляними кульками. Нуклеїнові кислоти осідали з розчину з використанням розчину, що складається з 0,1 частини 3 М ацетату натрію (рН 5,2) і 2,5 частин етанолу, інкубувалися на льоду, а потім центрифугувались протягом 30 хвилин при швидкості 12000 об/хвил. Осаджені нуклеїнові кислоти розчинялися потім в дистильованій воді (вільної від RN-аз і DN-аз) і зберігалися при - 20 °C. Фрагменти 16S rRNA були ампліфіковані ПЦР, що проводиться з бактерійними праймерами (27F; 5'AGAGTTTGATCCTGGCTCAG3', 1492R; 5'TGACTGACTGAGGYTACCTTGTTACGACTT3'). ПЦР проводилася в об'ємі 20-мкл за допомогою GeneAmp PCR System 2700 (Applied Biosystems, Foster City, CA) таким чином: 4 хвил. при 94 °C, потім 30 циклів по 1 хвил. при 94 °C, 1 хвил. при 50 °C, і 1,5 хвил. при 72 °C, потім 7 хвил. при 72 °C. ПЦР амплікони піддавалися електрофорезу і очищенню за допомогою Wizard SV Gel 96709 4 and PCR Clean-Up System (Promega, Madison, USA). Очищені амплікони були клоновані з використанням pCR 2,1 вектора, культури Е.соlі, а також ТА cloning kit (Invitrogen) відповідно до рекомендацій виробника. З добової культури за допомогою Mini prep spin kit (Quiagen, Crawley, UK) одержана ДНК плазмід, що містить 16S rDNA. Очищені ДНК плазмід секвенували на АВІ PRISM3100Genetic Analyzer за допомогою Big Dye Terminator cycle-sequencing kit (Applied Biosystems). Ампліфіковані продукти 27F-1492R були секвеновані в обох напрямках з праймерами 27F, 357F (5'-CTACGGGAGGCAGCAG-3'), 520R (5'ACCGCGGGGTGCTGGC-3'), 920F (5'AACTCAAAGGAATTGACGG-3'), 1080R (5'CCCAACATCTCACGAC-3') і 1492R, як описано (International Journal of Systematic and Evolutionary Microbiology, 1997, том 47, С. 54-57). Довжина послідовності склала 1488bp. Використовуючи BLAST (журнал Nucleic Acids Research, 1997, №25, С. 3389-3402) було проведено порівняння одержаної послідовності з іншими. З використанням CLUSTAL W software package (журнал Nucleic Acids Research, 1994, №22, С. 4673-4680) по методу Saitou і Nei (журнал Molecular Biology and Evolution, 1987, №4, С. 406-425) було побудовано філогенетичне дерево. Нуклеотидна послідовність 16S rRNA була задепонована в DDBJ/EMBL/GeneBank під номером АВ178889, ідентифікаційний номер 20040510203204.24251. Тестування культури Bacillus sp. F на вищих організмах (мушках Drosophila melanogaster і лабораторних мишах) здійснювалося по загальноприйнятих методиках в Тюменському науковому центрі Сибірського відділення РАН, Інституті хімічної біології і фундаментальної медицини Сибірського відділення РАН, Саратовському державному університеті, Університеті Хоккайдо, Інституті геронтології НАН України, Дніпропетровському національному університеті, Харківському національному фармацевтичному університеті і інших наукових центрах. Результати тестування у всіх випадках були практично ідентичні. При тестуванні на мушках наголошувалося істотне перевищення частки особин обох статей, які вижили з 24-ої по 42-у добу експерименту в дослідних варіантах в порівнянні з контролем. Декларовані в заявленому винаході положення чітко виявилися і при тестуванні на лабораторних мишах. Експерименти проводилися на мишах лінії С57В6, в середньому по 15 особин в кожній групі. В першій серії експериментів вивчався вплив доз культури на параметри імунної системи молодих тварин (вік 3-4 місяці). В контролі використовували дві групи тварин, одна з яких була інтактною, а другій групі вводили фізіологічний розчин. Бактерійну культуру Bacillus sp. F вводили тваринам однократно внутрішньо-очеревинно - 5000; 50000; 500000; 5000000 і 50000000 мікробних тіл (м.т.) на тварину. В другій серії експериментів оцінювався вплив бактерійної культури на фізіологічні і поведінкові реакції старіючих особин (вік 17 місяців), при цьому культуру вводили однократно внутріш 5 ньо-очеревинно в дозі 5000 м.т. Контрольна група була представлена тваринами того ж віку. Евтаназія тварин проводилася методом дислокації шийних хребців. По стандартних методиках оцінювалися морфофізіологична активність тимуса і селезінки по індексу органу (відношення ваги органу до ваги тіла %), активність чинників неспецифічної імунорезистентності по рівню фагоцитарної (ФП %) і метаболічної (НСТ-тест, %) активності селезінкових макрофагів, клітинного імунітету в реакції ГЗТ in vivo, активність гуморального імунітету по числу антитілотвірних клітин (АТК) в 1 мільйоні ядроутримуючих клітин в селезінці, м'язова сила тварин в тесті підняття вантажу, поведінкові реакції в тесті "Відкрите поле", а також тривалість життя. Встановлено, що Bacillus sp. F в дозі 5000 мікробних тіл сприяє збільшенню індексів тимусу і селезінки. Культура бацили в малій дозі (5000 м.т.) стимулює, а в середніх дозах (500000 і 5000000 м.т.) - пригнічує фагоцитарну активність селезінкових макрофагів. Штам Bacillus sp. F майже у всіх дозах підвищує активність гуморального імунітету, а доза в 5000 м.т. сприяє збільшенню функціональної активності і клітинного і гуморального імунітету. У зв'язку з цим для досліджень впливу культури на тривалість життя була вибрана доза в 5000 м.т. Мінімальний термін життя мишей з контрольної групи склав 589 днів, а максимальний - 833 дні. Мінімальний термін життя мишей з дослідної групи склав 836 днів, а максимальний - 897. Вплив штаму Bacillus sp. F при парентеральному введенні 5000 клітин на тривалість життя лабораторних мишей 17-місячного віку був значним: 100 % тварин проживало майже ще 11 місяців, а 20 % - 12 місяців, в той час, як у контрольній групі лише 70 % тварин проживало віку у 9 місяців і тільки 30 % - до 10 місяців. Вага тіла у тварин дослідної групи була істотно вище, ніж у тварин контрольної групи через 2 місяці після введення культури. М'язова сила у дослідних тварин збільшилася приблизно на 60 % щодо однолітків з контрольної групи. Про підвищення у тварин здібності до орієнтації в просторі і дослідницькій активності свідчили більш часті відвідини ними внутрішніх секторів відкритого поля, збільшення числа вертикальних стійок і відвідин нірок. Штам досліджений як імуномодулюючі біокоректори, здатні запускати природжену імунну відповідь. Активація імунітету була досліджена в експериментах по зміні метаболічної активності макрофагів, рівнів інтерферона-гамма (IFN-), фа Комп’ютерна верстка А. Рябко 96709 6 ктора некрозу пухлин (TNF-) і неспецифічної цитотоксичної дії Т-лімфоцитів під впливом клітин Bacillus sp. F. Встановлено, що інтраперитонеальні ін'єкції штаму в діапазоні доз 5000-5000000 м.т. на тварину приводять до дозозалежної активації метаболізму інтраперитоніальних макрофагів більш ніж в 2 рази, що оцінювалась по рівню хімічно активних перехідних з'єднань аеробного метаболізму (ROIs). Однократні внутрішньо-очеревинні ін'єкції в дозі 5000 м.т. приводять до збільшення рівнів IFN- в 2,6 разу, а також сприяють значному зниженню TNF-. Цитотоксична дія Т-лімфоцитів, одержаних з селезінки тварин після ін'єкцій Bacillus sp. F, була досліджена in vitro проти клітин лімфосаркоми миші RLS. Встановлено, що достовірна активація неспецифічного клону Тлімфоцитів відбувається при дозі 5000000 м.т., при цьому цитотоксична дія таких Т-лімфоцитів проти клітин лімфосаркоми була в 1,8 разу вище, ніж їх дія без активації штамом. Таким чином, посилення метаболізму макрофагів, підвищення рівня інтерферону-гамма, зниження чинника некрозу пухлин і активація цитотоксичної дії Т-лімфоцитів під впливом Bacillus sp. F. свідчать про активацію природженого імунітету у лабораторних тварин і про яскраво виражені імуномодулюючі властивості штаму Bacillus sp. F. Таким чином, бактерійна культура, що заявляється, при парентеральному введенні стимулює імунну систему і покращує емоційну стійкість лабораторних тварин. Збільшення тривалості життя мишей дійсно свідчить про присутність в культурі Bacillus sp. F геропротекторів. Таке істотне збільшення тривалості життя експериментальних тварин в перекладі на людський вік означає більше 100 років повноцінного активного життя. Сировинна база початкового мікроорганізму на планеті практично невичерпна, тільки в Російській Федерації кріолітозона займає близько 70 % території країни, яка може бути "постачальником" і інших унікальних і поки що не відкритих реліктових мікроорганізмів. Вважаємо, що після більш детального дослідження механізмів виживання виявленої реліктової бактерії протягом багатьох тисячоліть і дії її культури на макроорганізми в аптечних мережах Росії, України і інших країн з'являться нові препарати, які дозволять серйозно (і, можливо, кардинально) відсунути межу старості і поліпшити якість життя. Підписне Тираж 23 прим. Державна служба інтелектуальної власності України, вул. Урицького, 45, м. Київ, МСП, 03680, Україна ДП “Український інститут промислової власності”, вул. Глазунова, 1, м. Київ – 42, 01601

Дивитися

Додаткова інформація

Назва патенту англійською

Strain of epibiotic bacteria bacillus sp. f with immunomodulating activity and heroprotective ability

Автори англійською

Sokolovskyi Ivan Ivanovych, Hriva Hiennadiii Ivanovich, Brushkov Anatolii Viktorovich, Sokolovskyi Serhii Ivanovych

Назва патенту російською

Штамм реликтовых бактерий bacillus sp. f, который имеет иммуномодулирующую активность и геропротекторной способность

Автори російською

Соколовский Иван Иванович, Грива Геннадий Иванович, Брушков Анатолий Викторович, Соколовский Сергей Иванович

МПК / Мітки

МПК: C12R 1/125, A61K 35/74, C12N 9/14

Мітки: здатність, має, активність, штам, геропротекторну, бактерій, реліктових, bacillus, імуномодулюючу

Код посилання

<a href="http://uapatents.com/3-96709-shtam-reliktovikh-bakterijj-bacillus-sp-f-shho-maeh-imunomodulyuyuchu-aktivnist-i-geroprotektornu-zdatnist.html" target="_blank" rel="follow" title="База патентів України">Штам реліктових бактерій bacillus sp. f, що має імуномодулюючу активність і геропротекторну здатність</a>

Подібні патенти