Штами lactobacillus plantarum як гіпохолестеринемічні агенти

Номер патенту: 107089

Опубліковано: 25.11.2014

Автор: Куньє Кастельяна Хорді

Є ще 16 сторінок.

Дивитися все сторінки або завантажити PDF файл.

Формула / Реферат

1. Композиція, яка містить ефективну кількість щонайменше одного зі штамів, вибраних із групи, яку складають Lactobacillus plantarum CECT 7527, Lactobacillus plantarum CECT 7528 та Lactobacillus plantarum CECT 7529 або їх штами-мутанти, причому згадані штами-мутанти одержані шляхом застосування депонованих штамів як початкового матеріалу, і згадані штами-мутанти зберігають або додатково поліпшують холестеринзнижувальну активність вихідних штамів.

2. Композиція за п. 1, яка містить ефективну кількість щонайменше одного зі штамів, вибраних із групи, яку складають Lactobacillus plantarum CECT 7527, Lactobacillus plantarum CECT 7528 та Lactobacillus plantarum CECT 7529.

3. Композиція за п. 1, яка містить ефективну кількість штамів Lactobacillus plantarum CECT 7527, Lactobacillus plantarum CECT 7528 та Lactobacillus plantarum CECT 7529 або штамів-мутантів зазначених штамів, причому згадані штами-мутанти одержані шляхом застосування депонованих штамів як початкового матеріалу і зберігають або додатково поліпшують холестеринзнижувальну активність вихідних штамів.

4. Композиція за п. 3, яка містить ефективну кількість штамів Lactobacillus plantarum CECT 7527, Lactobacillus plantarum CECT 7528 та Lactobacillus plantarum CECT 7529.

5. Композиція за будь-яким із пп. 1-4 для застосування як пробіотик.

6. Композиція за будь-яким із пп. 1-4 для застосування як профілактичний та/або терапевтичний агент.

7. Композиція за п. 6 для застосування з метою запобігання серцево-судинним розладам та/або лікування серцево-судинних розладів.

8. Композиція за будь-яким із пп. 5-7 для застосування як гіпохолестеринемічний агент.

9. Композиція за будь-яким із пп. 5-8 для застосування у комбінації із статинами.

10. Композиція за будь-яким із пп. 5-9 для застосування у суб'єктів із гіперабсорбцією стеролів.

11. Фармацевтичний продукт, який містить ефективну кількість композиції за будь-яким із пп. 1-4 разом з відповідними кількостями фармацевтично прийнятних наповнювачів.

12. Ветеринарний продукт, який містить ефективну кількість композиції за будь-яким із пп. 1-4 разом з відповідними кількостями ветеринарно прийнятних наповнювачів.

13. Їстівний продукт, який містить ефективну кількість композиції за будь-яким з пп. 1-4 разом з відповідними кількостями інших їстівних інгредієнтів.

14. Їстівний продукт за п. 13, який являє собою дієтичну добавку.

15. Їстівний продукт за п. 14, який являє собою нутріцевтик.

16. Їстівний продукт за будь-яким із пп. 14-15, який має форму таблетки, капсули, сиропу або драже.

17. Їстівний продукт за п. 13, який являє собою молочний продукт або м'ясний продукт.

18. Штам Lactobacillus plantarum, який має гіпохолестеринемічну активність, вибраний з групи, яку складають Lactobacillus plantarum CECT 7527, Lactobacillus plantarum CECT 7528 та Lactobacillus plantarum CECT 7529.

Текст

Дивитися

Реферат: Винахід належить до композиції, яка містить ефективну кількість щонайменше одного із штамів, вибраних з групи, до складу якої входить Lactobacillus plantarum CECT 7527, Lactobacillus plantarum CECT 7528 та Lactobacillus plantarum CECT 7529 для запобігання та/або лікування серцево-судинних розладів. UA 107089 C2 (12) UA 107089 C2 UA 107089 C2 5 10 15 20 25 30 35 40 45 50 55 60 Ця заявка претендує на пріоритет за заявкою на європейський патент № 09172613.3, поданою 09 жовтня 2009 року, та попередньою заявкою на патент США № 61/265,095, поданою 30 листопада 2009 року. Галузь застосування винаходу Цей винахід стосується галузей медицини, мікробіології та харчування і, зокрема, нових пробіотичних штамів Lactobacillus plantarum для застосування з метою зниження рівня холестерину. Передумови створення винаходу Аномально високі рівні холестерину (гіперхолестеринемія) значною мірою пов'язуються із захворюваннями серцево-судинної системи, оскільки вони активізують розвиток атером у артеріях. Потенційно гіпохолестеринемічні фармацевтичні препарати і харчові продукти постійно розробляються з метою контролювання рівня сироваткового холестерину у суб'єктів з аномально високими рівнями останнього. Механізм дії цих фармацевтичних препаратів може полягати у зупинці циркуляції у кишечнику та печінці (EHC) солей жовчних кислот. Метаболізм солей жовчних кислот і метаболізм холестерину є тісно пов'язаними. Солі жовчних кислот являють собою водорозчинні екскреторні кінцеві продукти холестерину і є незамінними для емульгування жирів у шлунково-кишковому тракті. Вони синтезуються у печінці, головним чином як гліко- або таурокон'югати. Солі жовчних кислот секретуються декілька разів на добу (у середньому, шість) у дванадцятипалій кишці і проходять через порожню кишку до клубової кишки. Під час кишкового транзиту більшість солей жовчних кислот реабсорбується з поверненням до печінки через портальну вену. Невелика частка втрачається з фекаліями, і ця втрата повинна наново синтезуватись з ендогенного холестерину у печінці. Наслідком підвищення кількості солей жовчних кислот, які втрачаються з фекаліями, є підвищений рівень неосинтезу холестерину, таким чином ефективно зменшуючи ендогенний пул холестерину. Дія групи застосовуваних на цей час гіпохолестеринемічних лікарських препаратів, які називають смолами (холестирамін (Cholestyramine), колестіпол (Colestipol), колесевелам (Colesevelam)), полягає саме у цьому механізмі дії. Окрім фармацевтичних або хірургічних спроб зниження рівнів сироваткового холестерину шляхом зупинки циркуляції у кишечнику та печінці (EHC) солей жовчних кислот, висувалось припущення, що поглинання певних бактеріальних клітин могло б також впливати на рівні холестерину. Кишкові бактерії можуть впливати на рівні холестерину шляхом асиміляції екзогенного холестерину з їжі у бактеріальних мембранах або шляхом декон'югації солей жовчних кислот. Під час кишкового транзиту солі жовчних кислот зазнають ряду бактеріальних трансформацій, однією з найважливіших з яких є декон'югація солей жовчних кислот. Здатність до декон'югації (або гідролізу) солей жовчних кислот зустрічається у деяких видів кишкових молочнокислих бактерій (МКБ), але також і у бактерій інших родів. При декон'югації солей жовчних кислот, гліцин або таурин вивільняється із стероїдної частки молекули, наслідком чого є утворення вільних (декон'югованих) солей жовчних кислот. Вільні солі жовчних кислот з більшою легкістю осаджуються при низьких значеннях рН. Вони також реабсорбуються з меншою ефективністю у порівнянні з їхніми кон'югованими аналогами. Таким чином, декон'юговані солі жовчних кислот екскретуються з фекаліями з більшою легкістю, ніж кон'юговані солі жовчних кислот. Декон'югація солей жовчних кислот впливає на циркуляцію у кишечнику та печінці шляхом підвищення екскреції солей жовчних кислот і, як вважають, є набагато більш ефективною у зниженні рівнів холестерину у крові, ніж просте затримання екзогенного холестерину. Гідролаза солей жовчних кислот (BSH), фермент, що відповідає за декон'югацію солей жовчних кислот під час EHC, була виявлена у декількох видів МКБ, які є властивими для шлунково-кишкового тракту. Tanaka et al. (дивись, "Screening of Lactic Acid Bacteria for Bile Salt Hydrolase Activity", Journal of Dairy Science 1999, vol. 82, p. 2530-35) перевірив більше 300 штамів МКБ родів Bifidobacterium та Lactobacillus і видів Lactococcus lactis, Leuconostoc mesenteroides та Streptococcus thermophilus. Результати, одержані для 273 штамів, показали, що активність гідролази солей жовчних кислот (BSH) є неоднорідно розподіленою серед різних видів. За даними цього дослідження, майже усі біфідобактеріальні штами мають активність BSH, у той час як ця активність може бути виявлена лише у окремих штамів лактобактерій. Lactobacillus plantarum являє собою грам-позитивну аеротолерантну МКБ, широко розповсюджену у багатьох ферментованих харчових продуктах, а також в анаеробних речовинах рослинного походження. Вона також присутня у слині (з якої вона була спочатку виділена). Штами L. plantarum є особливо придатними для промислового одержання ферментованих харчових продуктів завдяки їхньому доброму коефіцієнту виживаності у ході 1 UA 107089 C2 5 10 15 20 25 30 35 40 45 50 55 60 процесу виготовлення та впродовж періоду консервації, а також завдяки їхнім високим показникам профілю підкислення та добрим органолептичним властивостям. Деякі штами L. plantarum також вважаються пробіотиками. Пробіотики являють собою живі мікроорганізми, які, у разі введення у адекватних кількостях, справляють благотворний вплив на здоров'я хазяїна. Бактерії, щоб бути віднесеними до числа пробіотиків, повинні задовольняти декільком вимогам, які пов'язані, окрім іншого, з їхньою відсутністю токсичності, життєздатністю при досягненні нижнього відділу шлунково-кишкового тракту (ШКТ) та адгезії до слизової оболонки кишечнику. Більшість бактерій-пробіотиків належить до групи МКБ, однак, незважаючи на це, загальновідомо, що пробіотичні характеристики та переваги є надзвичайно залежними від штаму, навіть серед МКБ одного виду. Наявний у продажу штам L. plantarum 299v, як правило, вважається пробіотичним, і він був описаний як такий, що знижує рівні фібриногену та холестерину у сироватці при поглинанні його у формі пробіотичного напою (дивись, Bukowska et al., "Decrease in fibrinogen and LDLcholesterol levels upon supplementation of diet with Lactobacillus plantarum in subjects with moderately elevated cholesterol" Atherosclerosis 1998, vol. 137, p. 437-38). Однак зниження рівня ЛНЩ (ліпопротеїн низької щільності)-холестерину при проведенні цих досліджень було дуже помірним і супроводжувалось таким же слабким зниженням рівня ЛВЩ (ліпопротеїн високої щільності)-холестерину. Жодних даних стосовно активності гідролази солей жовчних кислот L. plantarum 299v не публікувалось. Таким чином, бажано забезпечити нові поліпшені пробіотичні штами для застосування у ролі гіпохолестеринемічних агентів. Суть винаходу Цей винахід пропонує нові поліпшені пробіотичні штами для зниження рівня холестерину у крові і, як наслідок, для запобігання та лікування серцево-судинних розладів. Автори цього винаходу пропонують три нові пробіотичні штами Lactobacillus plantarum, виділені з людських фекалій. Було встановлено, що згадані штами мають надзвичайно високу активність BSH. Як згадувалось вище, тісний взаємозв'язок, який існує між високою активністю бактеріальної BSH і зниженням рівня холестерину, робить ці штами придатними для застосування у ролі гіпохолестеринемічних агентів. Робочі приклади, наведені нижче, демонструють, що ці штами мають значно вищу активність BSH у порівнянні з відповідними комерційно доступними штамами L. plantarum, такими як штами L. plantarum 299v або L. plantarum, які є присутніми у наявній у продажу суміші пробіотичних мікроорганізмів VSL#3. Показано також, що штами за цим винаходом є ефективними у зниженні рівня холестерину у культуральних середовищах, які містять розчинний холестерин. Незважаючи навіть на те, що кожен з нових штамів сам по собі демонструє переваги у порівнянні з відомими штамами, ці переваги збільшуються у разі застосування трьох згаданих штамів разом, що демонструє присутність синергічного ефекту. Холестеринзнижувальна активність штамів за цим винаходом була також продемонстрована in vivo. Наведений нижче приклад демонструє, що продукт, який містить пробіотичні штами за цим винаходом, є особливо ефективним у зниженні холестерину у разі введення суб'єктам з гіперхолестеринемією. Відповідним чином, перший аспект цього винаходу стосується композиції, яка містить ефективну кількість щонайменше одного із штамів, вибраних з групи, яку складають Lactobacillus plantarum CECT 7527, Lactobacillus plantarum CECT 7528 та Lactobacillus plantarum CECT 7529 або їх штами-мутанти, де згадані штами-мутанти одержують шляхом застосування депонованих штамів як початкового матеріалу, і де згадані штами-мутанти зберігають або додатково поліпшують холестеринзнижувальну активність вихідних штамів. За конкретним варіантом здійснення, цей винахід стосується композиції, що містить ефективну кількість щонайменше одного із штамів, вибраних з групи, яку складають Lactobacillus plantarum CECT 7527, Lactobacillus plantarum CECT 7528 та Lactobacillus plantarum CECT 7529. Словосполучення "ефективна кількість", у значенні, вживаному у цьому описі, означає кількість активного агенту, достатньо високу для забезпечення досягнення бажаного корисного результату, однак достатньо низьку для запобігання виникнення серйозних з медичної точки зору побічних ефектів. Енший варіант здійснення цього винаходу стосується композиції, що містить ефективну кількість Lactobacillus plantarum CECT 7527, L. plantarum CECT 7528 та L. plantarum CECT 7529 або їх штамів-мутантів, де згадані штами-мутанти одержують шляхом застосування депонованих штамів як початкового матеріалу, і де згадані штами-мутанти зберігають або додатково поліпшують холестеринзнижувальну активність вихідних штамів. За конкретним варіантом здійснення, композиція за цим винаходом містить ефективну кількість Lactobacillus 2 UA 107089 C2 5 10 15 20 25 30 35 40 45 50 55 60 plantarum CECT 7527, L. plantarum CECT 7528 та L. plantarum CECT 7529. Зрозуміло, що завдяки застосуванню депонованих штамів як початкового матеріалу, фахівець у цій галузі техніки може легко, методами традиційного мутагенезу або повторної ізоляції, одержати додаткові мутанти або їх похідні, які зберігають описані в цьому описі відповідні ознаки та переваги. Таким чином, словосполучення "їх штам-мутант" стосується штамів-мутантів, які одержали шляхом застосування депонованих штамів як початкового матеріалу, де згадані штами-мутанти зберігають або підвищують холестеринзнижувальну активність вихідних штамів. Фахівець у цій галузі буде вирішувати питання стосовно застосування прийнятного способу визначення холестеринзнижувальної активності згаданих штамів. Приклади можливих способів визначення цієї активності наведені у представлених нижче прикладах. Перевага штамів за цим винаходом полягає у тому, що вони є особливо корисними як пробіотики. Як згадувалось вище, пробіотичні бактерії повинні задовольняти декільком вимогам, які стосуються життєздатності, адгезивності, благотворних ефектів та відсутності токсичності. Ці характерні ознаки пробіотиків є залежними від штаму, навіть серед бактерій одного виду. Таким чином, важливо знайти ті штами, які мають кращі показники за всіма вимогами до пробіотиків. Наведені нижче приклади демонструють, що представлені штами мають надзвичайно добрі характерні ознаки пробіотиків. Штами за цим винаходом продемонстрували, що вони є високорезистентними до умов шлунково-кишкового середовища ссавців (кисле середовище, високі концентрації лізоциму, солей жовчних кислот та пероксиду кисню), завдяки чому є здатними пережити проходження через ШКТ. Згадані штами також характеризуються доброю адгезивністю до епітелію кишечнику, що дозволяє їм утримуватись у шлунково-кишковому тракті та справляти їхні пробіотичні ефекти. При порівнянні з іншими наявними у продажу штамами, штами за цим винаходом демонструють більш високу стійкість до умов ШКТ і кращу адгезійну здатність. Крім того, вони також продемонстрували свою безпечність, оскільки вони не мають токсичних дій, вони не призводять до посилення транслокації МКБ і не полегшують транслокацію ентеробактерій у ссавців-хазяїв. Крім того, ці штами справляють декілька благотворних ефектів у організмі хазяїна. Окрім своєї холестеринзнижувальної активності, вони справляють благотворний вплив на баланс кишкової мікрофлори завдяки своїй антагоністичній активності. Словосполучення "антагоністична активність" означає пригнічення росту неблаготворних бактерій шлунковокишкового тракту завдяки активності пробіотичних бактерій. Стан наявності порушеного мікробного балансу шлунково-кишкового тракту є відомим як дисбактеріоз і має численні негативні наслідки для самопочуття людини. Нижче буде показано, що згадані штами мають підвищену здатність пригнічення росту патогенних штамів у порівнянні з іншими наявними у продажу штамами L. plantarum. Згадані штами також продукують великі кількості коротколанцюгових жирних кислот (КЛЖК). Продукування КЛЖК з незасвоюваного волокна є цікавою здатністю пробіотиків. Ця здатність є бажаною для пробіотиків, оскільки продуковані КЛЖК демонструють декілька корисних властивостей у організмі хазяїна (дивись, Wong J., "Colonic health: fermentation and short chain fatty acids", J Clin Gastroenterol 2006, vol. 40, p. 235-43). Серед КЛЖК, значний інтерес для обсягу цього винаходу представляє продукування пропіонової та масляної кислот. Перша згадана кислота має протизапальні властивості, корисні з точки зору зниження системного запалення. Глобальне запалення має місце у разі атерогенезу, що є одним з найважливіших факторів ризику виникнення серцево-судинних захворювань (дивись, Naruszewicz M., "Potential parapharmaceuticals in the traditional Polish diet" 2005, Journal of Physiology and Pharmacology, vol. 56, suppl 1, p. 69-78). Загальновідомо, що масляна кислота є корисною для епітелію товстої кишки, оскільки вона є головним джерелом енергії для клітин товстої кишки. Завдяки справлянню декількох благотворних ефектів у організмі людини-хазяїна, ці пробіотичні бактерії є корисними як терапевтичні або профілактичні агенти. Зокрема, штами за цим винаходом є ефективними у зниженні рівнів холестерину у крові. Як пояснювалось вище, високі рівні холестерину значною мірою пов'язуються із захворюваннями серцево-судинної системи, оскільки вони стимулюють розвиток атером у артеріях. Таким чином, штами за цим винаходом є придатними для запобігання або лікування розладів серцево-судинної системи. Відповідно, ще один аспект цього винаходу стосується композиції, що містить ефективну кількість щонайменше одного із штамів за цим винаходом або їх штамів-мутантів для застосування як профілактичного та/або терапевтичного агенту. За варіантом здійснення, якому віддають перевагу, композиція за цим винаходом є призначеною для застосування з метою профілактики або лікування розладів серцево-судинної системи у тварини, у тому числі людини. 3 UA 107089 C2 5 10 15 20 25 30 35 40 45 50 55 60 За іншим варіантом здійснення, якому віддають перевагу, цей винахід пропонує застосування композиції, опис якої наведено вище, для виготовлення лікарського засобу для профілактики та/або лікування розладів серцево-судинної системи. Альтернативно це можна сформулювати як спосіб запобігання та/або лікування розладів серцево-судинної системи у тварини, у тому числі, людини, який включає введення ефективної кількості композиції за цим винаходом згаданій тварині, яка цього потребує. За іншим варіантом здійснення композиція за цим винаходом застосовується як гіпохолестеринемічний агент. За додатковим варіантом здійснення цей винахід пропонує застосування композиції, опис якої наведено вище, для виготовлення лікарського засобу для зниження рівня холестерину. Альтернативно це можна сформулювати як спосіб зниження рівня холестерину у тварини, у тому числі людини, який включає введення ефективної кількості композиції за цим винаходом згаданій тварині, яка цього потребує. Композиція за цим винаходом може бути введена як здоровим суб'єктам, так і пацієнтам, що страждають на розлад коронарного кровообігу. За конкретним варіантом здійснення суб'єкт, що одержує композицію за цим винаходом, страждає на гіперхолестеринемію. Пробіотичні композиції за цим винаходом мають додаткову перевагу, яка полягає у відсутності побічних ефектів, які викликаються стеролами рослинного походження, які були описані як протипоказані у комбінації з статином у суб'єктів з гіперабсорбцією стеролів. Нещодавно одержані результати дозволяють висунути припущення про те, що певний залишковий ризик розвитку розладу коронарного кровообігу у разі монотерапії статином є наслідком застосування статинів, які фактично підвищують ризик розвитку розладу коронарного кровообігу у пацієнтів з дуже високим рівнем поглинання стеролів, у тому числі стеролів рослинного походження. Кількість суб'єктів з гіперабсорбцією стеролів становить приблизно 25 % населення, і у більшості з них були виявлені поліморфізми АТФ-зв'язувальних касетних напівпереносників ABCG8 (Goldstein M. et al, "Statins, plant sterol absorption, and increased coronary risk". Journal of Clinical Lipidology, 2008, vol. 2, p. 304-305). Окрім того, було висунуто припущення про те, що результати збагачення раціону стеролами рослинного походження та терапії статином є адитивними у підвищенні рівнів стеролів рослинного походження у крові та тканинах, і що це є особливо очевидним у пацієнтів з дуже високим рівнем поглинання стеролів. Пробіотична композиція за цим винаходом не має цих недоліків і може вводитись будь-яким людям та у комбінації із статинами або будь-якими іншим холестеринзнижувальним лікарським засобом. Тому за конкретним варіантом здійснення, композицію за цим винаходом вводять суб'єктам з гіперабсорцією стеролів. За іншим конкретним варіантом здійснення, композицію за цим винаходом вводять у комбінації із статином. Штами за цим винаходом також активізують імуномодуляторні ефекти у хазяїна, оскільки вони індукують секрецію слизовою оболонкою кишечнику поліпшеного набору цитокінів. Ці імуномодуляторні ефекти є благотворними для хазяїна, оскільки вони допомагають досягти поліпшеної стійкості до захворювань та зменшують ризик виникнення алергій. Відомо, що грамнегативні бактерії, які існують у ШКТ, мають молекули LPS (ліпополісахарид) на поверхні їх клітин, що індукують продукування маркерів запальногопроцесу клітинами слизової оболонки кишечнику. Додавання пробіотиків може змінити цю ситуацію на користь більшої присутності грам-позитивних бактерій у ШКТ (які утворюють групу молочнокислих бактерій), з кращою пристосованістю до середовища або з антагоністичними властивостями проти деяких грамнегативних мікроорганізмів, знижуючи тим самим присутність ліпополісахаридів у слизовій оболонці кишечнику. Тим не менш, деякі пробіотичні мікроорганізми демонструють здатність модулювання per se продукування цитокінів, які є молекулами-месенджерами, що регулюють запальні та імунні реакції у організмі. Зокрема, деякі пробіотичні бактерії індукують краще збалансовану схему передачі про/антизапальних сигналів у слизовій оболонці кишечнику (без зменшення кількості грам-негативних бактерій). Як зазначено вище, ця бактеріально стимульована імуномодуляція має також протиатеросклеротичний ефект. Як буде показано нижче, було встановлено, що штами за цим винаходом стимулюють per se зниження рівнів α-фактору некрозу пухлин (TNF-α), який викликає запальні процеси, та підвищення рівнів протизапального інтерлейкіну-10 (IL-10), що продукується клітинами слизової оболонки кишечнику, індукуючи тим самим секрецію слизовою оболонкою кишечнику поліпшеного набору цитокінів. Ця імуномодуляторна дія доповнюється антагоністичними властивостями штаму, які стосуються зменшення присутності патогенних грам-негативних бактерій у ШКТ і зниження кількості ліпополісахаридів у слизовій оболонці кишечнику. Композиціям за цим винаходом, які містять ефективну кількість щонайменше одного з депонованих штамів або їх мутантів, може надаватись форма їстівних фармацевтичних або 4 UA 107089 C2 5 10 15 20 25 30 35 40 45 50 55 60 ветеринарних продуктів, в яких згадані штами є єдиними активними агентами або змішаними з одним або декількома іншими активними агентами та/або змішаними з фармацевтично або ветеринарно прийнятними наповнювачами (у разі фармацевтичного або ветеринарного продукту) чи прийнятними добавками. За конкретним варіантом здійснення цього винаходу, згадані продукти додатково містять один або декілька додаткових активних агентів. За варіантом, якому віддають перевагу, згаданим додатковим активним агентом або агентами є інші пробіотичні бактерії. В залежності від композиції, штами можуть додаватись як очищені бактерії, як бактеріальна культура, як частина бактеріальної культури, як бактеріальна культура, яка була піддана подальшій обробці, самостійно або разом з відповідними носіями або інгредієнтами. Додаватись можуть також пребіотики з одержанням симбіотичної композиції. За конкретним варіантом здійснення, композиції за цим винаходом додатково містять пребіотик, вибраний з групи, яку складають фруктоолігосахариди та галактоолігосахариди. За іншим аспектом, цей винахід пропонує фармацевтичний та/або ветеринарний продукт, який містить ефективну кількість композиції, яка містить щонайменше один з депонованих штамів або їх штами-мутанти, разом з прийнятними кількостями фармацевтично або ветеринарно прийнятних наповнювачів. У цьому аспекті, фармацевтичний продукт може одержуватись для введення пероральним шляхом у формі таблеток, драже, капсул, мікрокапсул, гранул, суспензій, сиропів, ліофілізованих порошків, рідких препаратів і т.ін. Вибір наповнювачів та найбільш прийнятних способів одержання з урахуванням конкретного призначення композиції здійснюється фахівцем у галузі фармацевтичної технології. Незважаючи на те, що перевага надається введенню пероральним шляхом, можливими є інші способи, такі як введення ін'єкційним шляхом, ректальним шляхом або місцеве застосування. Словосполучення "фармацевтично прийнятні", у значенні, вживаному у цьому описі, стосується сполук, матеріалів, композицій та/або лікарських форм, які, з медичної точки зору, є прийнятними для застосування у контакті з тканинами суб'єкта (наприклад, людини) без надмірної токсичності, подразнення, алергійної реакції або іншої проблеми або ускладнення, та відповідають розумному співвідношенню благотворна дія/ризик. Кожен носій, наповнювач і т.ін. повинні також бути "прийнятними" у значенні сумісності з іншими інгредієнтами композиції. Прийнятні носії, наповнювачі і т.ін. можна знайти у звичайних фармацевтичних довідниках. Подібним чином, словосполучення "ветеринарно прийнятний" означає прийнятний для застосування у контакті з тканинами тварини, яка не є людиною. Штами за цим винаходом також можуть входити до складу різноманітних їстівних продуктів, наприклад, молочних продуктів, йогурту, кисломолочного сиру, сичужного сиру (наприклад, кварка, вершкового сиру, плавленого сиру, м'якого і твердого сиру), кислого молока, сухого молока, продукту ферментації на основі молока, морозива, продукту ферментації на основі зернових, порошкового молока, напою, приправи і корму для домашніх тварин. Словосполучення "їстівний продукт" застосовують у цьому описі у найширшому значенні, включаючи продукт будь-якого типу, у будь-якій формі представлення, який може поїдатись твариною, але за виключенням фармацевтичних і ветеринарних продуктів. Прикладами інших їстівних продуктів є м'ясні продукти (наприклад, печінковий паштет, франкфуртські сосиски, ковбаса типу салямі або м'ясні пасти), шоколадні пасти, начинки (наприклад, трюфелі, крем) та цукрова глазур, шоколад, кондитерські вироби (наприклад, карамель, льодяники або іриски), хлібобулочні вироби (торти/кекси, мучні кондитерські вироби), соуси і супи, фруктові соки та забілювачі для кави. Їстівними продуктами, які представляють особливий інтерес, є дієтичні добавки та суміші для дитячого харчування. За сутністю цього винаходу, дієтичні добавки включають також нутріцевтики, які, як відомо, є екстрактами харчових продуктів, які справляють цілющий ефект на людське здоров'я. Корми для тварин також включаються до обсягу цього винаходу. Композиції за цим винаходом можуть також застосовуватись як інгредієнт інших харчових продуктів. Таким чином, за іншим аспектом цього винаходу, пропонується їстівний продукт, який містить композицію за цим винаходом разом з прийнятними кількостями їстівних інгредієнтів. За варіантом, якому віддають перевагу, композиція за цим винаходом представляє собою дієтичну добавку. Ефективна кількість колонієтвірних одиниць (cfu) для кожного штаму у композиції буде визначатись фахівцем у цій галузі і буде залежати від кінцевого складу композиції. Наприклад, у 5 їстівних продуктах штам або штами є присутніми у кількості від приблизно 10 cfu/г до 12 7 приблизно 10 cfu/г, за варіантом, якому віддають перевагу, - від приблизно 10 cfu/г до 12 приблизно 10 cfu/г, відповідно до чинного законодавства. Словосполучення "колонієтвірна одиниця" ("cfu") визначається як кількість бактеріальних клітин, виявлена шляхом мікробіологічного підрахунку на чашках з агаровим середовищем. 5 UA 107089 C2 7 Дієтичні добавки, як правило, містять пробіотичні штами у кількості в межах від 10 cfu/г до 10 cfu/г. За конкретним варіантом здійснення, композиція за цим винаходом представляє 9 11 собою дієтичну добавку, що містить від 10 cfu/г до 10 cfu/г, за варіантом, якому віддають 11 перевагу,  приблизно 10 cfu/г, депонованих штамів. За іншим варіантом здійснення, дієтична 9 добавка містить 10 cfu/г штаму або штамів за цим винаходом. Прийнятні схеми введення композиції за цим винаходом можуть встановлюватись фахівцем у цій галузі. Композиція за цим винаходом може вводитись один раз на добу, один раз на тиждень, декілька днів на тиждень або декілька разів на добу. За іншим варіантом здійснення, 9 добова доза містить 10 cfu штаму або штамів за цим винаходом. Штами за цим винаходом одержують шляхом культивування бактерій на прийнятних живильних середовищах та за прийнятних умов. Згадані штами можуть культивуватись самостійно з утворенням чистої культури або разом з іншими мікроорганізмами як змішана культура, або шляхом культивування бактерій різних типів окремо з подальшим об'єднанням їх у заданих пропорціях. Після культивування клітинну суспензію виділяють і використовують як таку або обробляють необхідним чином, наприклад, шляхом концентрування або ліофілізації, для подальшого застосування у виготовленні фармацевтичного препарату або їстівних продуктів. Еноді пробіотичний препарат піддають процесу іммобілізації або інкапсуляції для подовження строку придатності при зберіганні. У цій галузі відомі декілька способів іммобілізації або інкапсуляції бактерій (дивись, Kailasapathy et al., "Microencapsulation of Probiotic Bacteria: Technology and Potential Applications", Curr Issues Intest Microbiol 2002, vol. 3, p. 39-48). Якщо композицію за цим винаходом застосовують як дієтичну добавку, вона може вводитись як така, може змішуватись з прийнятною питною рідиною, наприклад, водою, йогуртом, молоком або фруктовим соком, чи може змішуватись з твердим або рідким харчовим продуктом. За цих обставин дієтична добавка може бути у формі таблеток, драже, капсул, гранул, порошків, суспензій, саше, пастилок, льодяників, плиток, сиропів та відповідних форм введення, як правило, у формі стандартної дози. За варіантом, якому віддають перевагу, композицію за цим винаходом призначають у формі таблеток, капсул, сиропів або драже, виготовлених традиційними способами виготовлення фармацевтичних продуктів. Як показано у прикладах, наведених нижче, кожен із запропонованих штамів має поліпшені характеристики у порівнянні з наявними на ринку штамами L. plantarum, такими як L. plantarum 299v або L. plantarum VSL#3. Зокрема, три згадані штами справляють поліпшені гіпохолестеринемічні ефекти завдяки своїй надзвичайно високій активності BSH. Таким чином, кожен із згаданих штамів може застосовуватись у композиції за цим винаходом самостійно або у поєднанні з іншими штамами за цим винаходом. Наприклад, композиція за цим винаходом може містити ефективну кількість штаму L. plantarum CECT 7527 окремо або разом з фармацевтично прийнятними наповнювачами або їстівними інгредієнтами, консервантами і т.ін. Композиція за цим винаходом може також містити ефективну кількість штаму L. plantarum CECT 7527 у комбінації з штамом L. plantarum CECT 7528 та/або штамом L. plantarum CECT 7529 разом з фармацевтично прийнятними наповнювачами або їстівними інгредієнтами, консервантами і т.ін. За додатковим аспектом, цей винахід пропонує штам Lactobacillus plantarum, вибраний з групи, до складу якої входять Lactobacillus plantarum CECT 7527, Lactobacillus plantarum CECT 7528 та Lactobacillus plantarum CECT 7529 або їх штами-мутанти, де згадані штами-мутанти одержують із застосуванням депонованих штамів як початкового матеріалу, і де згадані штамимутанти зберігають або додатково поліпшують холестеринзнижувальну активність вихідних штамів. За конкретним варіантом здійснення, згаданий штам вибирають як один з депонованих штамів. Наведені нижче розділи описують гіпохолестеринемічні можливості штамів за цим винаходом, а також їхню таксономічну характеризацію та їхні специфічні пробіотичні ознаки, у тому числі їхні впливи на імунну систему. Ці приклади не призначені для обмеження цього винаходу. Одержані результати демонструють, що штами за цим винаходом мають поліпшені пробіотичні ознаки у порівнянні з наявним у продажу штамом L. plantarum 299v. Крім того, показано, що композиція, яка містить штами за цим винаходом, має кращу in vivo холестеринзнижувальну активність, ніж відомі композиції, які містять стероли рослинного походження. Якщо не визначається інше, усі технічні та наукові терміни, вживані у цьому описі, мають таке саме значення, яке традиційно розуміється пересічним фахівцем у тій галузі, до якої належить цей винахід. При практичному втіленні цього винаходу можуть застосовуватись способи та матеріали, подібні або еквівалентні тим, які наведені у цьому описі. Термін "містить" та його варіанти у описі та пунктах формули винаходу не означають 12 5 10 15 20 25 30 35 40 45 50 55 60 6 UA 107089 C2 5 10 15 20 25 30 35 40 45 50 виключення інших технічних ознак, добавок, компонентів або стадій. Додаткові цілі, переваги та ознаки цього винаходу стануть очевидними для фахівців у цій галузі після вивчення опису або можуть бути виявлені при практичному втіленні цього винаходу. Наведені нижче приклади та фігури представлені з ілюстративною метою і не призначені для обмеження цього винаходу. Крім того, цей винахід охоплює усі можливі комбінації конкретних та переважних варіантів здійснення, опис яких наведено. Стислий опис фігур Фіг. 1. Електрофореграми пульсувального поля Sma-I (A)- та Sfi-I (B)-рестриктованої геномної ДНК: 1, Lactobacillus plantarum 299v; 2, F2099; 3, F3147; 4, Lactobacillus plantarum VSL#3; 5, F3276. Приклади 1. In vitro гіпохолестеринемічна активність нових штамів Штами за цим винаходом були виділені з фекалій немовлят і вибрані з-посеред інших 500 бактеріальних штамів за їх високими показниками при тестуванні активності гідролази солей жовчних кислот (BSH) за допомогою методу, опис якого наведено нижче. Вибрані штами показали чітке грам-позитивне забарвлювання, а також бактеріальну морфологію і не утворювали спор. Штами були депоновані за Будапештським договором у Еспанській колекції типових культур (Colecciуn Espaсola de Cultivos Tipo (CECT), Universidad de Valencia, Edificio de investigaciуn, Campus de Burjassot, 46100 Burjassot, Valencia). Був виданий відповідний сертифікат життєздатності, і штами одержали такі вихідні номери депонування: Lactobacillus plantarum CECT 7527 (який у цьому описі також називають F2099), Lactobacillus plantarum CECT 7528 (який у цьому описі також називають F3147) і Lactobacillus plantarum CECT 7529 (який у цьому описі також називають F3276). Дата депонування штамів F3276 і F2099 у CECT – 07.05.2009, а штаму F3147 – 15.07.2009. Гіпохолестеринемічну активність штамів додатково досліджували in vitro і порівнювали з наявними у продажу контрольними штамами, штамом L. plantarum 299v (далі Lp 299v) та штамом L. Plantarum, що входив до складу наявної у продажу культури VSL#3 (далі Lp VSL#3). Як вказувалось вище, були описані два механізми зниження рівнів холестерину, спричиненого молочнокислими бактеріями, а саме неосинтез холестерину, спричинений декон'югацією солей жовчних кислот, та засвоєння екзогенного холестерину з раціону. Таким чином, усі штами були піддані аналізу на активність BSH та тесту на зниження рівнів холестерину у культурі. Додатково змішані культури, які містили різні комбінації нових штамів, аналізували для визначення того, чи існують серед штамів синергічні ефекти відносно BSH та активності щодо зниження рівнів холестерину у середовищах. Методики експерименту відповідали опису Hyeong-Jun Lim et al. (дивись, "Isolation of cholesterol lowering lactic acid bacteria from human intestine for probiotic use", J Vet Sci 2004, vol. 5, p. 391-5) з незначними модифікаціями. 1.1. Активність гідролази солей жовчних кислот Штами культивували протягом ночі на живильному середовищі MRS (pH 6,4) при температурі 30 °C у атмосфері, яка містила 5 % CO2. Після інкубації культури стандартизували 8 до 10 cfu/мл, і одержали такі змішані культури: F2099+F3147, F2099+F3276, F3147+F3276, F2099+F3147+F3276. Змішані культури містили однакову кількість кожного із складових штамів і однакову загальну бактеріальну концентрацію з одноштамовими культурами. Як одноштамові культури, так і змішані культури аналізували на активність BSH. Розчинами культур імпрегнували стерилізовані паперові диски на чашках з агаровим середовищем MRS, доповненим 4 % розчином (у відношенні маси до об'єму) натрієвої солі тауродеоксихолевої кислоти (TDCA, компанія Sigma, США) та 0,37 г/л CaCl2. Чашки інкубували за анаеробних умов при температурі 37 °C протягом 72 год., і визначали діаметр зон преципітації навколо дисків. Потім обчислювали активність BSH шляхом віднімання діаметру диску (DD) від діаметру зони інгібування (IZD) та поділу цієї різниці на два за такою формулою GI = (IZD-DD)/2 (дивись Таблицю 1). 7 UA 107089 C2 Таблиця 1 Активність гідролази солей жовчних кислот (BSH) F2099 F3147 F3276 F2099+F3147 F2099+F3276 F3147+F3276 F2099+F3147+F3276 Lp 299V Lp VSL#3 5 10 15 20 25 Активність BSH 2,10 2,53 3,17 2,63 3,35 2,90 3,65 1,70 2,00 Ці результати демонструють, що штами за цим винаходом мають високу активність декон'югації солей жовчних кислот. Крім того, активність BSH кожного з окремих штамів F2099, F3147 і F3276 є більшою за відповідний показник наявних у продажу штамів Lp 299v та Lp VSL#3, причому найвищу активність має штам F3276. Окрім того, коли штами об'єднані у змішаній культурі, активність BSH змішаної культури є більшою за відповідний показник одноштамових культур при однаковій загальній бактеріальній концентрації. Активність BSH особливо підвищується при об'єднанні трьох згаданих штамів, наслідком чого є активність BSH, яка приблизно вдвічі перевищує відповідний показник для Lp 299v. Виявляється, таким чином, що між штамами за цим винаходом існує синергічний ефект стосовно активності BSH. 1.2. Холестеринзнижувальна здатність відносно живильних середовищ Тест на зниження рівня холестерину проводили із застосуванням розчинного холестеринового бульйону MRS. Одноштамові та змішані культури одержували, як пояснювалось вище. Розчинний холестерин (поліоксиетанілхолестерину себацат, компанія Sigma, США) фільтрували через ультратонкий фільтр (0,45 мкм), і додавали до автоклавованого бульйону MRS, який містив 0,05 % L-цистеїну, до кінцевої концентрації 300 8 мг/мл. Об'єм інокуляційного матеріалу становив 15 мкл розчину бактеріальної культури (10 cfu/мл), який одержували, як описано вище, на 1 мл холестеринового бульйону MRS. Після цього матеріал інкубували за анаеробних умов при температурі 37 °C протягом 24 год. Неінокульований бульйон MRS також інкубували за таких самих умов. Після інкубування бактеріальні клітини видаляли шляхом центрифугування, і супернатанти культури L. plantarum та неінокульований контроль аналізували на залишковий вміст холестерину за допомогою автоматичного аналізатору (Olympus AU400). Такий самий експеримент проводили з 1 % (у відношенні маси до об'єму) бульйоном MRS, який містив солі жовчних кислот (солі жовчних кислот від компанії SIGMA C4951), оскільки остання комбінація більше нагадує середовище кишечнику. Результати цих аналізів наведені у Таблиці 2 і представлені як % зниження рівня холестерину у порівнянні з неінокульованим контролем. Таблиця 2 Холестеринзнижувальна здатність бактеріальних культур у живильному середовищі % зниження холестерину F2099 F3147 F3276 F2099+F3147 F2099+F3276 F3147+F3276 F2099+F3147+F3276 Lp 299V Lp VSL#3 10,10 9,60 9,30 9,84 11,82 10,72 13,01 4,58 7,40 8 % зниження холестерину (1 % солей жовчних кислот) 42,70 42,70 42,00 43,00 47,20 44,27 50,85 26,70 27,80 UA 107089 C2 5 10 15 20 25 30 35 40 45 Ці результати знову ж таки демонструють, що штами за цим винаходом мають кращі гіпохолестеринемічні ефекти у порівнянні з добре відомими наявними у продажу штамами Lp 299v та Lp VSL#3. Крім того, показано, що холестеринзнижувальні ефекти є кращими при об'єднанні трьох штамів за цим винаходом у змішаній культурі. 2. Таксономічна характеризація штамів Для таксономічної характеризації штами за цим винаходом вирощували протягом ночі на середовищі MRS (pH 6,4) при температурі 30 °C у атмосфері, яка містила 5 % CO2. Далі бактерії збирали, промивали, ресуспендували у буфері для передчасного лізису (480 мкл EDTA, 50 мМ, pH 8,0; 120 мкл лізоциму, 10 мг/мл), і потім інкубували при температурі 37 °C протягом 60 хв. ДНК екстрагували за допомогою набору для очищення геномної ДНК Wizard (компанія Promega). Після центрифугування попередньо оброблених бактерій при 14000 g протягом 2 хв для видалення супернатанту далі діяли, дотримуючись методики компанії Promega. Коротко кажучи, бактерії ресуспендували у розчині для лізису ядер (Nuclei Lysis Solution) та інкубували при температурі 80 °C протягом 5 хв, після чого охолоджували до кімнатної температури. Клітинні лізати інкубували у розчині РНКази при температурі 37 °C протягом 60 хв, білки осаджували шляхом додавання розчину для осадження білків (Protein Precipitation Solution), і перемішували з високою швидкістю. Проби охолоджували і центрифугували при 15000 g протягом 3 хв. Супернатанти, які містили ДНК, переносили до чистих 1,5 мл мікроцентрифужних пробірок і змішували з 600 мкл ізопропанолу шляхом перевертання. ДНК збирали центрифугуванням при 15000 g протягом 2 хв, і обережно зливали супернатант. Проби ДНК промивали 600 мкл 70 % етанолу шляхом обережного декількаразового перевертання пробірок. Етанол видаляли відсмоктуванням після центрифугування при 15000 g протягом 2 хв. На закінчення, осад ДНК ресуспендували у 100 мкл регідратаційного розчину (Rehydration Solution) шляхом інкубування при температурі 65 °C протягом 1 год. Проби зберігали при температурі 28 °C. 2.1. Родова та видова генетична ідентифікація 16S рРНК була ампліфікована за допомогою ПЛР із застосуванням універсальних праймерів Eub27f та Eub1492r, які продукують фрагмент майже повної послідовності 16S (більше 1000 нуклеотидів) (Таблиця 3). У подальшому ДНК, яку одержали, як пояснювалось вище, промивали із застосуванням набору Quiaquick (компанія Quiagene). Чотири послідовні секвенувальні реакції провели для кожної проби у аналізаторі Genetic Analyzer 3130 (компанія Applied Biosystems) із застосуванням набору BigDye v.3.1 з використанням праймерів, представлених у Таблиці 3. Збирання даних і обробку хроматограм проводили за допомогою програми DNA Sequence Analysis v.5.2 (компанія Applied Biosystems), і перевіряли шляхом візуального аналізу за допомогою Chromas (компанія Technelysium Pty Ltd.) та BioEdit (компанія Ibis Biosciences). Родову ідентифікацію здійснювали за допомогою бази даних Ribosomal Database Project tool (Q. Wang et al., "Naive Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy", Appl. Environ. Microbiol. 2007, vol. 73, p. 5261-7). Видову ідентифікацію здійснювали шляхом порівняння одержаної послідовності з 16S послідовностями відомих мікроорганізмів як з бази даних RefSeq (http://www.ncbi.nlm.nih.gov/RefSeq/) за допомогою BLASTN, так і з бази даних Ribosomal Database Project (http://rdp.cme.msu.edu/, J.R. Cole et al., "The Ribosomal Database Project (RDP-II): introducing myRDP space and quality controlled public data" Nucl. Acids Res. 2007, vol. 35, p. 169-72). База даних RDP ідентифікувала три штами F2099, F3147 та F3276 як такі, що належать до виду Lactobacillus plantarum Таблиця 3 Праймери, застосовані для ампліфікування та секвенування 16S гену Стадія Ампліфікація Праймер Eub27f Eub1492r Секвенування 27f 357f 907r 1492r 5"  3" послідовність GAGTTTGATCCTGGCTCAG (SEQ ID NO: 1) TACGGYTACCTTGTTACGACTT (SEQ ID NO: 2) AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 3) CGCCCGCCGCGCCCCGCGCCCGGCCCGCC GCCCCCGCCCCCCTACGGGAGGCAGCAG (SEQ ID NO: 4) CCGTCAATTCCTTTGAGTTT (SEQ ID NO: 5) GGTTACCTTGTTACGACTT (SEQ ID NO: 6) Орієнтація пряма зворотна пряма пряма зворотна зворотна 9 UA 107089 C2 5 10 15 20 25 2.2. Генотипування штаму Характеризацію здійснювали шляхом геномного розщеплення та гель-електрофорезу у пульсувальному полі. Штами F2099, F3147 та F3276 були піддані обробці за попередньо описаною методикою (A.M. Rodas et al., "Polyphasic study of wine Lactobacillus strains: taxonomic implications", Int J Syst Evol Microbiol 2005, vol. 55, p. 197-207). Штами Lp VSL#3 та Lp 299v також були включені до цього аналізу як контрольні. Усі штами вирощували на чашках з агаровим середовищем MRS та інкубували при температурі 37 °C, 5 % CO2 протягом 18 год. Клітини збирали і тричі промивали у 8 мл PET (10 мМ розчин Tris pH 7,6, 1 М розчин NaCl), потім центрифугували при 6000 об/хв протягом 10 хв. Осади ресуспендували у 700 мкл лізисного буферу (6 мМ розчин Tris, 1 M розчин NaCl, 0,1 M розчин EDTA, 0,5 % розчин SLS (лаурилсульфат натрію), 0,2 % розчин деоксихолевої кислоти; 1 мг/мл лізоциму; 40 Од/мл мутанолізину; 20 г/мл РНКази). До ресуспендованих клітин додавали однаковий об'єм 1,6 % агарози з низькою точкою плавлення (компанія FMC BioProducts, Rockland, штат Мен, США) з твердінням при температурі 4 °C протягом 1 год. Енсерційні сегменти переносили до 2 мл лізисного буферу II (0,5 M розчин EDTA, pH 9,2, 1 % розчину N-лаурилсаркозину та 1 мг/мл пронази) та інкубували при температурі 50 °C протягом 48 год. Після цього інсерційні сегменти промивали при кімнатній температурі за допомогою TE буферу (10 мМ розчин Tris, 1 мМ розчин EDTA, pH 8,0). Розщеплення тотальної ДНК здійснювали за допомогою рестриктаз Sfi-I та Sma-I (компанія Roche Diagnostics). Електрофорез у пульсувальному полі здійснювали за допомогою апарату CHEF DRIII (компанія BioRad Laboratories). Енсерційні сегменти навантажували на 1 % гель агарози (агароза SeaKem ME, компанія FMC BioProducts, штат Мен, США). У Таблиці 4 наведені умови проведення електрофорезу для кожної рестриктази. Як маркери молекулярної маси ДНК були застосовані Lambda ladder PFG Marker та Low Range PFG Marker (компанія New England Biolabs). Після закінчення електрофорезу гелі забарвлювали розчином етидію броміду з подальшою УФ-візуалізацією за допомогою системи GelDoc System (компанія BioRad). Таблиця 4 Умови проведення електрофорезу для Sfi-I- та Sma-I-рестриктованої геномної ДНК штамів F2099, F3147 та F3276 Рестриктаза Sfi-I Sma-I 30 35 40 45 50 Блок 1 2 1 Вихідний імпульс (с) 2 15 0,5 Кінцевий імпульс (с) 10 25 5 Час (год.) 10 6 16 Як показано на Фіг. 1, Sfi-I- та Sma-I-рестрикційні схеми, які одержали за допомогою електрофорезу у пульсувальному полі, були різними для штамів F2099, F3147 та F3276, чим підтверджується те, що вони належать до трьох різних штамів. Як і очікувалось, згадані схеми також відрізняються від схем для штамів Lp 299v та Lp VSL#3. У літературі було описано, що, на відміну від інших Lactobacillus, види L. plantarum представляють високу генетичну різнорідність (I. Sбnchez et al., "Polyphasic study of the genetic diversity of lactobacilli associated with 'Almagro' eggplants spontaneous fermentation, based on combined numerical analysis of randomly amplified polymorphic DNA and pulsed-field gel electrophoresis patterns" Journal of Applied Microbiology 2004, vol. 97, p. 446-58). Як показано результатами гель-електрофорезу у пульсувальному полі (PFGE), штами F2099, F3147 та F3276 виглядають генетично дуже близькоспорідненими, тому вони можуть мати однакове клональне походження (F.C. Tenover et al., "Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing" J Clin Microbiol 1995, vol. 33, p. 2233-9). 3. Резистентність до середовища шлунково-кишкового тракту Для визначення резистентності штамів F2099, F3147 та F3276 до транзиту через ШКТ, були проведені аналізи за умов, що імітують середовище шлунково-кишкового тракту ссавців. В результаті цього була здійснена кількісна оцінка виживаності після обробки лізоцимом, пероксидом кисню, кислим середовищем та солями жовчних кислот. Результати порівнювали з результатами, які були одержані для Lp 299v та Lp VSL#3. 3.1. Толерантність до лізоциму: 20 мкл аліквоти культури кожного бактеріального штаму, яку вирощували протягом ночі у MRS при температурі 37 °C, наносили на 96-лунковий планшет, і додавали 200 мкл середовища, яке доповнювали 100 мкг/мл, 200 мкг/мл або 300 мкг/мл лізоциму (компанія Sigma). Планшети інкубували при температурі 37 °C, 5 % CO2. Кількісну 10 UA 107089 C2 5 10 15 20 оцінку бактеріального росту здійснювали шляхом визначення підвищення оптичної густини при 620 нм за допомогою ELISA рідеру (спектрофотометру) під час інкубування від 0 год. до 6 год. Результати наведені у % у зіставленні з контролем, який представляє собою максимальний ріст кожного штаму у бульйоні MRS без додавання лізоциму (Таблиця 5). 3.2. Толерантність до пероксиду кисню: 20 мкл аліквоти культури кожного штаму, яку вирощували протягом ночі у MRS при температурі 37 °C, наносили на 96-лунковий планшет. У лунки додавали 200 мкл середовища, яке доповнювали 10 мкг/мл, 20 мкг/мл та 30 мкг/мл H 2O2, і планшети інкубували протягом 30 хв при температурі 37 °C перед зчитуванням при 620 нм після інкубування протягом 0-6 год. (Таблиця 6). 3.3. Толерантність до кислого середовища: 20 мкл аліквоти культури кожного штаму, яку вирощували протягом ночі у MRS при температурі 37 °C, наносили на 96-лунковий планшет, після чого на лунки, які містили бактерії, наносили 200 мкл аліквоти середовища MRS, погоджені з різними значеннями рН, за допомогою HCl. Після цього планшети витримували при температурі 42 °C, і підвищення оптичної густини зчитували за допомогою спектрофотометру при 620 нм у межах 0-6 год. Результати наведені у % у зіставленні з контролем, який представляє собою максимальний ріст кожного штаму у бульйоні MRS при рН 7,2 (Таблиця 7). 3.4. Толерантність до солей жовчних кислот: 20 мкл аліквоти культури кожного штаму, яку вирощували протягом ночі у MRS при температурі 37 °C, наносили на 96-лунковий планшет. У лунки додавали 200 мкл середовища, яке доповнювали 0,3 %, 0,5 % та 0,1 % (у відношенні маси до об'єму) солей жовчних кислот (SIGMA B8756-10G, 096K1213) з доведенням величини рН до 3. Проби також аналізували у 200 мкл середовища MRS з 0,3 % (у відношенні маси до об'єму) солей жовчних кислот без регулювання рН. Планшети витримували при температурі 37 °C, 5 % CO2 і зчитували за допомогою спектрофотометру при 620 нм у період часу з 0 год. до 6 год. (Таблиця 8). 25 Таблиця 5 Результати визначення оптичної густини (OD), виражені у % від контрольного MRS, після інкубування з різними концентраціями лізоциму F2099 F3147 F3276 Lp 299v Lp VSL#3 100 99,23 96,45 98,45 92,86 89,23 Концентрація лізоциму (мкг/мл) 200 99,65 95,72 98,12 90,02 87,12 300 97,55 93,66 94,67 85,19 81,19 Таблиця 6 Результати визначення оптичної густини, виражені у % від контрольного MRS, після інкубування з різними розведеннями H2O2 F2099 F3147 F3276 Lp 299v Lp VSL#3 10 96,12 98,45 95,12 95,34 97,12 Концентрація H2O2 (мкг/мл) 20 95,77 96,80 92,38 93,24 90,88 11 30 90,9 94,35 89,99 87,45 85,45 UA 107089 C2 Таблиця 7 Результати визначення оптичної густини, виражені у % від контрольного MRS, після інкубування при різних значеннях рН F2099 F3147 F3276 Lp 299v Lp VSL#3 2 60,45 62,08 58,24 52,34 55,34 2,5 62,67 65,80 58,23 51,56 56,74 3 66,58 71,20 60,22 57,34 61,10 3,5 70,23 74,32 63,56 58,03 62,45 рH 4 71,89 76,45 64,58 63,20 63,76 4,5 77,34 84,12 68,34 63,99 67,77 5 80,24 88,95 74,56 78,23 72,34 5,5 85,28 95,40 86,34 83,20 82,12 6 93,45 97,20 92,10 87,30 84,23 Таблиця 8 Результати визначення оптичної густини, виражені у % від контрольного MRS, після інкубування з різними концентраціями солей жовчних кислот F2099 F3147 F3276 Lp 299v Lp VSL#3 0,3* 117,85 136,08 109,80 102,45 104,65 Концентрація солей жовчних кислот (% відношення маси до об'єму) 0,3 pH 3 0,5 pH 3 109,34 103,23 128,01 107,34 104,30 93,67 94,35 89,34 99,49 92,12 1 pH 3 87,12 95,66 72,56 51,56 65,23 *Без регулювання величини рН. 5 10 15 20 25 30 Наведені результати вказують на те, що штами за цим винаходом мають добрі показники життєздатності у разі піддання впливу умов, які імітують середовище шлунково-кишкового тракту. Таблиця 5 і Таблиця 6 показують, що згадані штами є резистентними до високих концентрацій бактерицидних агентів, присутніх у ротовій порожнині (лізоцим та пероксид кисню). Життєздатність штамів є дуже доброю навіть при концентраціях, які перевищують фізіологічні умови (30 мкг/мл лізоциму та 10 мкг/мл H 2O2). Щодо кислих умов шлунку, життєздатність штамів також є задовільною. Крім того, штами за цим винаходом є надзвичайно стійкими до солей жовчних кислот (дивись Таблицю 8), навіть у комбінації з кислим рН, що спостерігається, як правило, при випорожненні шлунку. Загалом, результати показують, що штами за цим винаходом є життєздатними після проходження через ШКТ. Більше того, згадані результати показують, що штами за цим винаходом за аналізованих умов мають кращі показники, ніж наявні у продажу штами Lp 299v та Lp VSL#3. 4. Адгезія до кишечнику 4.1. Адгезія до слизу Адгезивну здатність штамів F2099, F3147 та F3276 порівнювали з адгезивною здатністю наявного у продажу штаму Lp 299v. Слиз одержували шляхом промивання кишечнику сумішшю PBS (pH 7,4), желатину (0,01 %) ® та інгібіторів протеаз (Complete , компанія Sigma). Слизову оболонку зішкрібали і розміщували у приймачі, який містив буфер, до складу якого входив 10 мМ розчин HEPES, в сольовому розчині Хенкса (pH 7,4) і такі самі інгібітори. Після цього слиз промивали шляхом центрифугування при 13000 об/хв протягом 10 хв тим самим буфером. Супернатанти зібрали, і вміст слизу визначили за методом Бредфорда. Мічені тритієм культури одержали наведеним нижче способом. 150 мкл аксенічних культур кожного з мікроорганізмів внесли до середовища MRS, доповненого міченим тритієм тимідином (5 мкл у 3 мл MRS), та інкубували протягом ночі при температурі 30 °C та 5 % CO2. Препарати центрифугували, і осади ресуспендували у фосфатно-сольовому буферному розчині до 8 концентрації 10 cfu/мл. Сигнал тритію, включений до мікроорганізмів, обчислюють за вихідним сигналом тритію (кількість мкл міченого тритієм тимідину, додана до живильного середовища) і сигналом супернатанту. Відношення між цим значенням (сигнал, включений до біомаси) і загальною кількістю мікроорганізмів у культурі представляє в результаті число розпадів на 12 UA 107089 C2 5 10 15 20 25 30 35 40 45 хвилину/cfu (сигнал/бактерія). За 24 год. до проведення аналізу адгезії 1 мл розчину слизу (0,5 мг/мл) інкубували у лунках планшету для проведення ELISA (твердофазний імуноферментний аналіз). Після промивання 8 до лунок додавали мічені тритієм препарати мікроорганізмів (110 cfu /мл) та інкубували протягом 60 хв при температурі 37 °C. Супернатанти з кожної лунки видаляли, лунки промивали середовищем MEM Alpha (компанія Gibco) і вишкрібали для видалення слизу-мікроорганізмів з лунок. Адгезію штамів обчислюють шляхом підрахунку сигналу тритію у препараті слизумікроорганізму у лунках за допомогою сцинтиляційного лічильника (Wallac 1410) і поділу на число розпадів на хвилину/cfu, як описано вище. Результатом є кількість бактерій, які 5 6 6 прикріпились на одиницю площини слизу. 6,8010 cfu, 6,5810 cfu та 7,3110 cfu штамів 2 F2099, F3147 та F3276, відповідно, можуть прикріпитись на 2см слизу кишечнику. У порівнянні з наявним у продажу штамом Lp 299v, штами за цим винаходом мають набагато кращу адгезивну здатність. 4.2. Адгезія до клітин лінії Caco-2 Клітини лінії Caco-2 ECACC № 86010202 одержали від Американської колекції типових культур (ATCC). Експериментальна методика визначення кількості бактерій, які прикріпляються на одиницю площини клітин лінії caco-2, є по суті такою самою, як і наведена вище для адгезії 2 6 до слизу. Результати показують, що до 2 см клітин лінії caco-2 можуть прикріпитись 3,1210 6 5 сfu, 2,1110 cfu та 5,1910 cfu штамів F2099, F3147 та F3276, відповідно. Е, знову ж таки, у порівнянні з наявним у продажу штамом Lp 299v, штами за цим винаходом мають кращу адгезивну здатність. 5. Аналізи токсичності Попередньо зафіксовану змішану культуру штамів F2099, F3147 та F3276 (ця змішана 10 культура надалі буде позначатись як AB-LIFE) протягом двох послідовних днів вводили (510 cfu/кг у PBS) шести пацюкам (самцям і самицям) лінії Wistar віком 9 тижнів загальною дозою 11 10 cfu/кг. Тварин годували кормом (Teklacd 2014) і водою ad libitum. Введення здійснювали після їжі на повний шлунок за допомогою шлункового зонду для перорального введення. За такою самою схемою харчувались 6 контрольних пацюків, які одержували лише PBS. Кожні два дні стан здоров'я тварин визначали шляхом оцінювання у балах таких параметрів, як маса тіла, поведінка і реакція на подразнення. Загальну оцінку становила сума балів для кожного з параметрів: маса тіла + поведінка + реакція на подразнення. У цілому, негативних ефектів на самопочуття тварин під час проведення досліджень помічено не було. Тварини були забиті на 7 день вдиханням CO2. Провели повну автопсію для виявлення макроскопічного ураження органів. Зразки мезентеріальних лімфовузлів і печінки відбирали для аналізу на бактеріальну транслокацію. Приблизно 5 мг кожного зразку гомогенізували у 1 мл 0,01 % суміші желатину-PBS. 100 мкл цього гомогенату висівали як на чашках із середовищем МакКонкі, так і на чашках із середовищем MRS. Колонії підраховували після інкубування при температурі 37 °C протягом 48 год. Результати представлені у Таблиці 9 і Таблиці 10. На чашках із середовищем MRS спостерігалось декілька колоній молочнокислих бактерій від контрольних тварин та тварин, які одержували AB-LIFE, що відповідало нормальній базальній транслокації МКБ (J.S. Zhou et al., "Acute oral toxicity and bacterial translocation studies on potentially probiotic strains of lactic acid bacteria", Food Chem Toxicol 2000, vol. 38, p. 153-61). На завершення, результати показують, що пероральне введення культури AB-LIFE є безпечним, оскільки воно не призводить до підвищення транслокації МКБ, а також не сприяє транслокації ентеробактерій. Усі тварини продемонстрували однакову зміну маси тіла під час проведення досліджень. У споживанні корму і води істотних різниць не спостерігалось. Не були виявлені ані клінічні симптоми, ані зміни стану здоров'я тварин. Під час гістопатологічного обстеження макроскопічних пошкоджень у органах і порожнинах виявлено не було. Таблиця 9 Бактеріальна транслокація до печінки тварин, які одержували AB-LIFE. Числа показують кількість тварин з позитивним бактеріальним ростом і максимальну кількість cfu/мг тканини Група Контроль AB-LIFE Стать Самці Самиці Самці Самиці Ентеробактерії (cfu/мг) 0/3 0/3 0/3 0/3 Молочнокислі бактерії (cfu/мг) 0/3 0/3 1/3 0/3 13 Максимальна транслокація, що спостерігалась (cfu/мг) 0 0 1 0 UA 107089 C2 Таблиця 10 Бактеріальна транслокація до мезентеріальних лімфовузлів тварин, які одержували AB-LIFE. Числа показують кількість тварин з позитивним бактеріальним ростом і максимальну кількість cfu/мг тканини Група Контроль AB-LIFE 5 10 15 Стать Самці Самиці Самці Самиці Ентеробактерії (cfu/мг) 0/3 0/3 0/3 0/3 Молочнокислі бактерії (cfu/мг) 1/3 1/3 1/3 1/3 Максимальна транслокація, що спостерігалась (cfu/мг) 1 1 1 1 6. Антагоністичні властивості Для визначення того, чи демонструють штами F2099, F3147 та F3276 за цим винаходом антагоністичні активності, провели дослідження за методом Кемпбела із застосуванням чашок з агаровим середовищем, засіяних бактеріальними патогенами у середовищі компанії Oxoid. Патогени, які застосовували при проведенні цього дослідження, вибирали з-посеред тих, які, як правило, існують у людському шлунково-кишковому тракті (дивись Таблицю 11). Чашки однорідно засівали за допомогою тампону і культивували до злиття при відповідній температурі у інкубаторі з 5 % CO2. Після цього циліндричні зрізи однорідно засіяних чашок з агаровим середовищем із злитими культурами штамів F2099, F3147 або F3276 розміщали у точній відповідності на чашках з патогенами та інкубували протягом ночі при температурі 37 °C. Наступного дня зони інгібування вимірювали шляхом розміщення чашок з агаровим середовищем на пласкій лінійці. Після цього активність з пригнічення росту обчислювали шляхом віднімання діаметру циліндрів (CD) від діаметру зон інгібування (IZD) та поділу цієї різниці на два за формулою GI = (IZD-CD)/2. Пригнічувальну здатність штамів за цим винаходом порівнювали з пригнічувальною здатністю наявних у продажу штамів Lp299v та Lp VSL#3. Таблиця 11 Показники пригнічення росту, обчислені за наведеною вище формулою Salmonella enterica Enteritidis CECT 4155 Salmonella enterica Typhimurium CECT 4594 Escherichia coli виділена з фекалій немовлят Proteus mirabilis CECT 484 Klebsiella oxytoca K108 CIP 103434 Pseudomonas aureginosa виділена з фекалій немовлят Yersinia pseudotuberculosis CIP 104896 Clostridium perfringens виділена з фекалій немовлят Clostridium ramnosum ATCC 13937 Enterococcus faecalis CIP A186 20 F2099 0,45 F3147 0,775 F3276 0,6 Lp VSL#3 0,6 Lp 299v 0,25 0,6 0,6 0,6 0,55 0,15 0,35 0,7 0,675 0,45 0,2 0,975 0,85 0,675 0 0 0,7 0,85 0,75 0,9 0,15 0,3 0,3 0,2 0,2 0 1 3 10,25 1,8 0,4 0 0 1,7 0,15 0 0 0 0,3625 0,2 0 0,625 0,8 0,7 0,45 0 Штами F2099, F3147 та F3276 пригнічували ріст більшості патогенних штамів, наведених у Таблиці 11. Таким чином, вони благотворно впливали на баланс мікрофлори кишечнику завдяки своїй здатності пригнічувати ріст патогенних штамів. Штами за цим винаходом мають, у цілому, кращі антагоністичні властивості у порівнянні з наявними у продажу контрольними штамами. 14 UA 107089 C2 5 10 15 20 25 30 7. In vitro оцінка імуномодуляторної здатності продукування цитокінів на моделі слизової оболонки кишечнику Вибраною моделлю слизової оболонки є лінія моноцитів THP-1, що обумовлюється їхньою чутливістю до бактеріальних компонентів типу LPS (як індуктору запальної реакції) та їхньою сприйнятливістю до модуляції продукування цитокінів при наявності у середовищі молекул, придатних до індукування продукування протизапальних цитокінів. Клітини лінії THP-1, одержані від ATCC, культивували у середовищі DMEM (модифіковане за способом Дульбекко середовище Егла) у 24-лункових планшетах для проведення ELISA до 6 кінцевої концентрації, приблизно, 10 моноцитів/лунку. Клітини стимулювали 10 нг/мл LPS протягом 2,5 год. перед доданням бактеріальних штамів. Штами F2099, F3147, F3276 та Lp 299v попередньо культивували протягом ночі у середовищі MRS при температурі 37 °C у атмосфері з 5 % CO2. Після завершення інкубації, концентрацію мікроорганізмів визначали за допомогою лічильної камери Нойбауера, і відповідним чином розбавляли для одержання кінцевого 7 співвідношення 25:1 (2,510 ) cfu/моноцити у 500 мкл DMEM у лунках планшетів для проведення ELISA з клітинами лінії THP-1. Кожне розведення здійснювали за допомогою середовища DMEM, доповненого гентаміцином (50 мкг/мл), ампіциліном (10 мкг/мл) та хлоранфеніколом (12 мкг/мл). Сумісне інкубування клітин лінії THP-1 із штамами L. plantarum тривало 24 год. Аліквоти для проведення додаткового аналізу відбирали через 6 год. і по завершенню експерименту. Аліквоти центрифугували, і супернатанти аналізували для TNF-α та IL-10 засобами протокової цитометрії із застосуванням наявного у продажу набору Human Soluble Protein Master Buffer (BD Cytometric Bead Array) за інструкціями виробника. Для інтерпретації одержаних результатів визначили та нормалізували нахил між значеннями, які визначили через 6 год. та 24 год. Нормалізований нахил обчислюють за наведеною нижче формулою, яка надається виробником: NS= ((1-IL значення 24 год. / IL значення 6 год.) / 24)  100; де NS - нормалізований нахил, IL (або TNF-α) значення – концентрація IL-10 або TNF-α на 6 год. або 24 год. Результати представлені у пг/мл. Причиною вибору цього способу є одержання стандартного значення, яке надає можливість здійснення порівняння трансверсальних параметрів між експериментами (Таблиця 12), оскільки еволюція концентрації цитокінів є більш цікавою, ніж їхнє абсолютне значення (пг/мл). За значеннями, які були одержані на 6 год., клітини лінії THP-1 все ще знаходяться під впливом індукції LPS; пізніше концентрація TNF-α підвищується, а IL-10 знижується. На 24 год. можна спостерігати повернення профілю продукування цитокінів (зниження TNF-α і підвищення IL-10). 35 Таблиця 12 Нормалізовані нахили, які показують індукцію (позитивний нахил) або пригнічення (негативний нахил) IL-10 та TNF-α у LPS-індукованих клітин лінії THP-1 F2099 F3147 F3276 Lp 299v 40 45 50 IL-10 20,56 37,56 31,46 21,42 TNF-α -1,23 -1,61 -2,34 -0,52 Як показано у Таблиці 12, LPS-індуковані клітини лінії THP-1 індукують продукування IL-10 у присутності штамів L. plantarum, причому індукція IL-10 є особливо високою у присутності штаму F3276. Крім того, F2099, F3147 та F3276 справляють більший пригнічувальний вплив на продукування запального TNF-α у порівнянні з наявним у продажу Lp 299v. 8. Продукування коротколанцюгових жирних кислот Для аналізу продукування пропіонової та масляної кислот штами за цим винаходом та контрольні штами культивували на основному живильному середовищі, доповненому 1 % (у відношенні маси до об'єму) кожного з наведених нижче волокон: інуліном (SIGMA I2255), пектином (SIGMA 76282) та фруктоолігосахаридами (FOS) (SIGMA F8052), які являють собою волокна, традиційно присутні у щоденному раціоні. Склад основного живильного середовища наведено у Таблиці 13. Згадане середовище піддавали попередньому інкубуванню протягом 12 год. у анаеробній атмосфері. Після інокуляції кожним зі штамів Lp, середовище інкубували протягом ночі при температурі 37 °C за анаеробних умов. Після цього культури, культивовані протягом ночі, центрифугували, і супернатант швидко заморожували у рідкому азоті для 15 UA 107089 C2 подальшого хроматографічного аналізу на хроматографі Agilent 1100 із застосуванням зворотнофазної колонки Tracer Extrasil ODS2 (3 мкм, 150,4 см). Результати визначення концентрації пропіонової та масляної кислот у пробах наведені у Таблиці 14. Таблиця 13 Склад основного живильного середовища Сполука Концентрація 2 г/л 2 г/л 0,1 г/л 0,04 г/л 0,04 г/л 0,01 г/л 0,01 г/л 2 г/л 0,05 г/л 0,5 г/л 0,5 г/л 2 г/л 10 мкл Пептон Дріжджовий екстракт NaCl K2HPO4 KH2PO4 MgSO4 7H2O CaCl2 6H2O NaHCO3 Гемін HCl цистеїн Солі жовчних кислот Tween 80 Вітамін K1 5 Таблиця 14 Продукування пропіонової та масляної кислот штамами L. plantarum, культивованими на основному живильному середовищі, яке містить інулін, пектин та фруктоолігосахариди F2099 F3147 F3276 Lp 299v 10 15 20 25 30 Пропіонова кислота (мг/мл) 15,546 12,23 44,939 12,898 Масляна кислота (мг/мл) 14,185 12,294 21,636 9,195 Виходячи з вищенаведених результатів, можна зробити висновок, що штами за цим винаходом продукують великі кількості пропіонової та масляної кислот, справляючи тим самим благотворні ефекти на організм хазяїна. 9. In vivo гіпохолестеринемічна активність Холестеринзнижувальний ефект пробіотичної композиції за цим винаходом у суб'єктів з гіперхолестеринемією вивчали шляхом проведення рандомізованого, подвійного сліпого, плацебоконтрольованого, паралельного клінічного дослідження. Згаданим дослідженням передбачалось також вивчення додаткових параметрів, пов'язаних із серцево-судинною системою, а також терпимості до пробіотичної композиції та її органолептичних властивостей. У цьому дослідженні приймали участь 60 суб'єктів з гіперхолестеринемією віком від 18 років 2 до 65 років. Ендекс маси тіла (BMI) учасників дослідження знаходився у межах 19-30 кг/м , повний сироватковий холестерин (повний-С) – 200-300 мг/дл, а ЛНЩ-холестерин знаходився у межах 130-190 мг/дл, за виключенням суб'єктів з двома або декількома факторами ризику виникнення проблем із серцево-судинною системою, ЛНЩ-холестерин у яких знаходився у межах 100-190 мг/дл. Жоден з учасників не проходив жодного курсу гіпохолестеринемічного лікування впродовж чотирьох тижнів, що передували згаданому дослідженню. Суб'єкти з гіпергліцеридемією, більшою за 350 мг/дл, або такі, що мали напад ішемічної хвороби серця протягом 6 місяців, що передували початку дослідження, з дослідження виключались. Виключались також вагітні жінки, жінки, які годували немовлят груддю та суб'єкти з алергією на будь-який з компонентів згаданих композицій. Різниця між учасниками-чоловіками та учасниками-жінками не перевищувала 20 %. Усі учасники надали письмову інформовану згоду на участь у дослідженні; методика проведення дослідження була перевірена і схвалена незалежним комітетом з етики. Протягом 12 тижнів учасники одержували перорально лише одну добову дозу або 9 контрольної композиції (плацебо), або пробіотичної композиції, яка містила 1,210 cfu змішаної 16 UA 107089 C2 5 культури з рівною пропорцією трьох штамів за цим винаходом, F2099, F3147 та F3276 (AB-LIFE 2). Склад композиції плацебо та композиції AB-LIFE наведено у Таблиці 15. Обидві композиції вводились у формі капсули з рослинного желатину. Параметри суб'єктів (ЛНЩ-C, повний-C, ЛНЩ/ЛВЩ, ЛНЩ-оксидований, тригліцериди, артеріальний тиск, базальна глікемія, маса тіла, індекс талії і стегон, жировий компонент тіла і самопочуття) відслідковувались протягом усього дослідження. Крім того, оцінювали органолептичні властивості та терпимість композицій. Визначені показники як для пробіотичної групи AB-LIFE 2, так і для групи, яка одержувала плацебо, піддавали статистичному аналізу із застосуванням програми SPSS. Таблиця 15 Склад пробіотичної композиції AB-LIFE 2 та плацебо (значення у мг/капсулу) Плацебо Кукурудзяний крохмаль: 100 мг Мікрокристалічна целюлоза (pH 10,2): 71,1 Тальк: 2,6 Магнію стеарат: 1,3 AB-LIFE 2 F2099, F3147 та F3276: 100 Мікрокристалічна целюлоза (pH 10,2): 71,1 Тальк: 2,6 Магнію стеарат:1,3 10 15 20 Результати клінічного дослідження наведені у Таблиці 16 і Таблиці 17. Середні значення та середні квадратичні відхилення показників повного-C, ЛНЩ-C та ЛНЩ-оксидованого перед та після обробки як для групи, що одержувала плацебо, так і для пробіотичної групи, наведені у Таблиці 16. Відсоткове зниження та результати внутрішньогрупових статистичних аналізів представлені у Таблиці 17. Таким чином, дійшли висновку, що AB-LIFE 2 є ефективним гіпохолестеринемічним агентом. Більше того, при порівнянні з продуктами подібного призначення, наприклад, стеролами рослинного походження, показник повного зниження холестерину, спричиненого споживанням AB-LIFE 2, є більш високим (Plana N. et al., "Plant sterol-enriched fermented milk enhances the attainment of LDL-cholesterol goal in hypercholesterolemic subjects", Eur J Nutr., 2008, vol. 47, p. 3239). Таблиця 16 Середні значення та середні квадратичні відхилення показників повного-C, ЛНЩ-C та ЛНЩ-оксидованого. t0 – вихідні значення; tf – значення на кінець 12-тижневого лікування Плацебо AB-LIFE Повний-C_t0 Середнє Середнє квадратичне відхилення 252,63 23,47 247,43 31,28 Повний-C_tf Середнє Середнє квадратичне відхилення 242 22,676 213,77 18,68 ЛНЩ-C_t0 Середнє Плацебо AB-LIFE Плацебо AB-LIFE 168,4 166,67 ЛНЩ-C_tf Середнє квадратичне відхилення 19,592 21,595 ЛНЩ-оксидований_t0 Середнє Середнє квадратичне відхилення 56,42 9,99 54,68 10,99 17 Середнє 158,53 142,17 Середнє квадратичне відхилення 18,17 13,28 ЛНЩ-оксидований_tf Середнє Середнє квадратичне відхилення 55,38 9,71 47,23 8,32 UA 107089 C2 Таблиця 17 Відсоток зниження (та внутрішньогруповий статистичний аналіз) показників повного-C, ЛНЩ-C та ЛНЩ-оксидованого у групі, що одержувала пробіотичну AB_LIFE Повний-C ЛНЩ-C ЛНЩ-оксидований 5 10 15 20 25 30 35 40 13,60 % (p

Додаткова інформація

Автори англійською

Cune Castellana, Jordi

Автори російською

Кунье Кастельяна Хорди

МПК / Мітки

МПК: A61K 35/74, A61P 9/00

Мітки: lactobacillus, гіпохолестеринемічні, штами, plantarum, агенти

Код посилання

<a href="http://uapatents.com/24-107089-shtami-lactobacillus-plantarum-yak-gipokholesterinemichni-agenti.html" target="_blank" rel="follow" title="База патентів України">Штами lactobacillus plantarum як гіпохолестеринемічні агенти</a>

Подібні патенти